We narrowed to 19,248 results for: Tat
-
Plasmid#116104PurposeLentiviral expression of AKT1 R121WDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only
-
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 PAK5
Plasmid#60532PurposeDonor vector for human Pak5DepositorInsertPak5 (PAK5 Human)
UseGateway CloningAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti‐puro‐OgRNA_mdxE53
Plasmid#187054PurposeSpCas9 gRNA correcting mdx4cv nonsense mutation with ABEDepositorInsertSpCas9 gRNA correcting mdx4cv nonsense mutation with ABE
UseLentiviralExpressionMammalianPromoterU6Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huBim_Ex3
Plasmid#85532PurposeInducible expression of guide RNA (huBim_Ex3) with fluorescent GFP reporterDepositorInserthu Bim
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAD100-CHIP-myc-His
Plasmid#236054PurposeMammalian expression of human CHIP with a C-terminal myc-His tagDepositorAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-TRIM21
Plasmid#207838PurposeInducible TRIM21 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsTagsweak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-osTIR1
Plasmid#207840PurposeInducible TIR1 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsosTIR
mCherry
mAID_-VHH-GFP4
Tags3X HA-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ROBO1-Fc(DAPA)-AviTag-6xHis
Plasmid#156998PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertROBO1 (ROBO1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD274-Fc(DAPA)-AviTag-6xHis
Plasmid#156660PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD274 (CD274 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-LILRB2-Fc(DAPA)-AviTag-6xHis
Plasmid#156863PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertLILRB2 (LILRB2 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG CMV14 / BRAF-G469A
Plasmid#131711PurposeMammalian Expression of Flag tagged BRAFDepositorAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCD565
Plasmid#153027PurposedxCas9(3.7), MCP-SoxS(R93A/S101A), J306 scRNADepositorInsertdxCas9(3.7), MCP-SoxS(R93A/S101A), J306 scRNA
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK2V678F-VSV
Plasmid#139349PurposeExpression of a gain of function TYK2-V678F protein (correspoding to JAK2-V617F)DepositorInsertTYK2 cDNA with 267nt of 5' UTR (TYK2 Human)
TagsVSVExpressionMammalianMutationV362F-V678FPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL680 CHYRON3 integration construct
Plasmid#126448PurposeTo integrate the CHYRON3 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON3 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001147582)
Plasmid#77732Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRetroX GFP Mps1 DK
Plasmid#63703PurposeInducible expression of GFP-Mps1 DK fusion in mammalian cellsDepositorInsertMps1 (TTK Human)
UseRetroviralTagsEGFPExpressionMammalianMutationdeletion of aa 47-156, kinetochore binding domainPromotertight TRE promoterAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-4A
Plasmid#51247PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907 mutated to AlaPromoterEF1aAvailable SinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
MCV-Rep-
Plasmid#32058DepositorInsertMCV-Rep- genome
MutationSingle cytosine to adenine (C/A) mutation at 2,07…Promoternone from vector. Insert contains native promoter…Available SinceOct. 25, 2011AvailabilityAcademic Institutions and Nonprofits only