We narrowed to 10,024 results for: CAG
-
Plasmid#76142Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_1
Plasmid#215236PurposeSupression of shcircHUWE1(19,20)_1 expressionDepositorInsertcircHUWE1 shRNA 1 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-4
Plasmid#193670PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-1
Plasmid#210013Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2K-LRL-IRES-Luc2
Plasmid#109230PurposeFor Tol2 transposon-mediated stable expression of LRL and IRES-luciferaseDepositorInsertLRL and Luc2
ExpressionMammalianPromoterCAGGSAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
TagsHAMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ROSA26(MultiFPsΔPuro)
Plasmid#140759PurposeTargeting vector to Gt(ROSA)26 locus for conditional expression of distinct FPs (Venus, mCherry, and mCerulean) responding to each site-specific-recombinase activity (Cre, Dre, and phiC31o).DepositorInsertspuromycin-N-acetyltransferase
Venus
mCherry
mCerulean
UseMouse TargetingPromoterCAGGSAvailable SinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR Human CASP9 -2
Plasmid#198420PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR Human CASP9 -1
Plasmid#198419PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_2
Plasmid#215235PurposeSupression of shcircHUWE1(19,20)_2 expressionDepositorInsertcircHUWE1 shRNA 2 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
nCre-ST-NLS-P2A-NLS-pSC-cCre
Plasmid#207638PurposeA plasmid encoding N-terminal Cre fused to SpyTag (ST) and photocaged SpyCatcher (pSC) fused to C-terminal Cre with a nuclear localization signal (NLS) sequenceDepositorInsertnCre-SpyTag-NLS-P2A-NLS-photocaged SpyCatcher-cCre
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_IL1RN
Plasmid#64151PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PRKD1 gRNA (BRDN0001146537)
Plasmid#77228Purpose3rd generation lentiviral gRNA plasmid targeting human PRKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3261
Plasmid#115458PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only