We narrowed to 10,878 results for: KIT;
-
Plasmid#162483PurposeSEC plasmid containing LG1 homology arms and myo-2p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit B3SE
Plasmid#49171PurposepHluorin-tagged GABA A receptor subunit (beta 3) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit beta 3 (Gabrb3 Mouse)
Tagsmyc, pHGFP (pHluorin), and thrombin cleavage site…ExpressionMammalianMutationGTG (V) to TGC (C)PromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJH130
Plasmid#162484PurposeSEC plasmid containing LG1 homology arms and myo-3p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
Plasmid#118273PurposepAAV vector for flippase dependent GCaMP6f expression under the control of EF1a promoterDepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…ExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW2171
Plasmid#163095PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-Fos
Plasmid#131593Purposedoxycycline-inducible expression of mouse c-Fos in mammalian cellsDepositorAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW2086
Plasmid#154335PurposeCrispr repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::GFP::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOD1988-epiDEG
Plasmid#89357PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pdpy-7 (epidermis specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Synthetic, Nematode)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPdpy-7Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dCas9-3xNLS-VP64 (Construct 1)
Plasmid#55195PurposeExpresses taCas9 in Mammalian cells for transactivating endogenous and synthetic promoters. The backbone is a lentiviral vector.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsVP64ExpressionMammalianPromoterCMV/hUBCAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW2172
Plasmid#163096PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4
Plasmid#170855PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-REX-GECO1
Plasmid#61248PurposeExpresses REX-GECO1 in neuronsDepositorInsertREX-GECO1
UseAAVExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJW1821
Plasmid#163092PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet^SEC (Lox511I)^::3xMyc
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-short_BrokenHeart (no BC)
Plasmid#86950PurposeAAV transfer plasmid containing the BrokenHeart construct: a hyperpiggybac donor transposon interrupting the tdTomato fluorophore. Transposase activity rescues coding sequence.DepositorInsertBrokenheart construct
UseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only