We narrowed to 10,272 results for: CAG
-
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v2-mU6-sgCebpb_v2-hU6-sgCebpd_v2
Plasmid#177258PurposeExpresses Cebpa_v2 (bU6), Cebpb_v2 (mU6), Cebpd_v2 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpb_v2/sgCebpd_v2
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_2
Plasmid#135753PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAP1LC3A-V1
Plasmid#98569PurposeExpresses MAP1LC3A-V1DepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pPN262
Plasmid#91607PurposeExpress sgRNA targeting human EPHX2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_3
Plasmid#36337DepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAH-MIBP16
Plasmid#51870PurposeExpresses C-terminal HA-tagged full length rat MIBP1 (cloned into pCAGGS)DepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PAK4 gRNA (BRDN0001146148)
Plasmid#77574Purpose3rd generation lentiviral gRNA plasmid targeting human PAK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
shMYB-2
Plasmid#247031PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid ProgenitorsDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 UROS_sg2
Plasmid#244874PurposeKnockout of human UROSDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR ATP23 sg1
Plasmid#244847PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only