We narrowed to 9,004 results for: sgRNA
-
Plasmid#133347Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets cpaA and second one targets blaA (from Caulobacter crescentus)DepositorInsertsgRNA_cpaA and sgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA- Pconstitutive-sgRNA(Sth3)_cpaA
Plasmid#133348Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets blaA and second one targets cpaA (from Caulobacter crescentus)DepositorInsertsgRNA_blaA and sgRNA_cpaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos4
Plasmid#233459PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 4, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 4, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5
Plasmid#233460PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti_DualsgRNAEmptyVector_Puro_T2A_BFP2
Plasmid#236729PurposeDual sgRNA empty vector expressing BFP with Puromycin selectionDepositorTypeEmpty backboneUseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA_expression_vector
Plasmid#210212PurposeAn empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.DepositorTypeEmpty backboneExpressionBacterial and MammalianPromoterU6Available SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330_Rosa_sgRNA
Plasmid#97007PurposeExpresses Cas9 and Rosa26 locus specific sgRNADepositorInsertRosa26 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
psgRNAc
Plasmid#114006Purposeexpress sgRNA, p15A, CRMDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHelper_ShCAST_sgRNA
Plasmid#127921PurposeExpresses ShCAST and an empty sgRNA scaffold. New targets can be added using Golden Gate assembly (LguI sites).DepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning (LguI sites)
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tRFP
Plasmid#169941PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tRFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regiā¦Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pnsgRNA
Plasmid#172717PurposeDelivery of guide RNA for prime editingDepositorInsertJ23119-gRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only