We narrowed to 11,022 results for: ENA;
-
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g1)-PGKpuroBFP-W
Plasmid#105028PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorInsertSlc25a51 (Slc25a51 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g2)-PGKpuroBFP-W
Plasmid#105029PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorInsertSlc25a51 (Slc25a51 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g1)-PGKpuroBFP-W
Plasmid#105035PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorInsertPou5f1 (Pou5f1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Kcmf1-g1)-PGKpuroBFP-W
Plasmid#105017PurposeLentiviral gRNA plasmid targeting mouse Kcmf1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-27a-5p
Plasmid#103382PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-27a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-27a-5p target (MIR27A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30c-2-3p
Plasmid#103414PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-2-3p target (MIR30C2 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-96-3p
Plasmid#103760PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-96-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-96-3p target (MIR96 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-98-3p
Plasmid#103762PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-98-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-98-3p target (MIR98 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-98-5p
Plasmid#103763PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-98-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-98-5p target (MIR98 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-99b-3p
Plasmid#103766PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-99b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-99b-3p target (MIR99B Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-876-5p
Plasmid#103743PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-876-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-876-5p target (MIR876 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-887-3p
Plasmid#103746PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-887-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-887-3p target (MIR887 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-887-5p
Plasmid#103747PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-887-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-887-5p target (MIR887 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-92a-2-5p
Plasmid#103751PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-92a-2-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-92a-2-5p target (MIR92A2 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-93-5p
Plasmid#103756PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-93-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-93-5p target (MIR93 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-802
Plasmid#103737PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-802 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-802 target (MIR802 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-657
Plasmid#103712PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-657 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-657 target (MIR657 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-659-3p
Plasmid#103713PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-659-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-659-3p target (MIR659 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-671-5p
Plasmid#103719PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-671-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-671-5p target (MIR671 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only