We narrowed to 16,346 results for: GRN
-
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Chr7_Centromere-Targeting_gRNA
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-gRNA_BbsI_CAM
Plasmid#183222PurposeLbCas12a gRNA containing BbsI restriction recognition sites in spacer sequence for Golden Gate AssemblyDepositorInsertLbCas12a guide RNA containing BbsI sites in spacer sequence
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-1
Plasmid#86924PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-gRNA
Plasmid#226867PurposeLentiviral expression of Sp-gRNA with BlpI and BstXI restriction sites for gRNA spacer cloning. Also expresses BFP.DepositorInsertLenti Sp-gRNA
UseLentiviralPromotermU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-2
Plasmid#86925PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTol2_LSEC:Cas9green; erbb2_gRNA171
Plasmid#199338PurposepDEL135; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous erbb2 sgRNADepositorInsertsLSEC
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with U6 promoter
Plasmid#48962Purposeto drive the sgRNA expression under a U6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pH-PABE-7-sgRNA
Plasmid#115621PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Chr1q_Cassette-Integration_gRNA
Plasmid#195126PurposegRNA in a third generation Cas9 vector with GFP, targeting location downstream of Chr1q_centromere-targeting_gRNA for positive-negative selection cassette integrationDepositorInsertChr1q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only