We narrowed to 2,727 results for: BFP
-
Plasmid#213009PurposeA lentiviral vector used to create stable cell lines expressing the ABE8e-SpRY base editor and BFPDepositorInsertABE8e-SpRY-D10A
UseCRISPR and LentiviralExpressionMammalianMutationD10A nickase variant of SpRYPromoterEf-1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac dCas9-VPR
Plasmid#191269PurposepiggyBac integration and dox-inducible expression of VPR-dCas9-HA-tagBFPDepositorInsertsVPR-dCas9-HA-tagBFP
rtTA3-IRES-PURO
UseCRISPRTagsHA and tagBFPExpressionMammalianAvailable sinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PiggyBac dCas9-KRAB
Plasmid#191314PurposepiggyBac integration and dox-inducible expression of KRAB-dCas9-HA-tagBFPDepositorInsertsKRAB-dCas9-HA-tagBFP
rtTA3-IRES-PURO
UseCRISPRTagsHA and tagBFPExpressionMammalianAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-FL-TagBFP
Plasmid#120921PurposeExpresses BFP tagged Ptch1DepositorAvailable sinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB+_attB53
Plasmid#183614PurposeRMCE vector to shuttle puromycin resistance, anti-GFP SynNotch receptor, tagBFP and TRE-mCherry cassettes into attP50-flanked landing pad (Addgene 183609). All cassettes on sense (+) strand.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti_DualsgRNAEmptyVector_Puro_T2A_BFP2
Plasmid#236729PurposeDual sgRNA empty vector expressing BFP with Puromycin selectionDepositorTypeEmpty backboneUseLentiviralAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
aTY65_pTRE_Wnt3a_IRES_tagBFP2_WPRE
Plasmid#225349PurposeLentiviral vector for Wnt3a and BFP expressionDepositorAvailable sinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-MYOD1-shOct4
Plasmid#182309PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into skeletal muscle cells via MYOD1 and shOCT4 expressionInsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianMutationshOct4PromoterEF1a and TRE3GAvailable sinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
attB-puro donor.dna
Plasmid#181923PurposeattB-puro DNA donor for twinPE and Bxb1 mediated gene-size insertionDepositorInsertattB-EGFP-EF1α-PuroR-T2A-TagBFP
ExpressionMammalianAvailable sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
SStart-36xMashTag-BFP-3xStop-24xPP7 (Sunstart-MashTag reporter)
Plasmid#128608PurposeExpresses 36xMashTag with SunTag frame as mainframe, followed by BFP linker and 24 repeats of PP7 hairpins in 3’ UTR.DepositorInsert36xMashTag
ExpressionMammalianPromoterPcmvAvailable sinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pATZ-BFP-HA-GFP11
Plasmid#177721PurposeER protein alpha-1-antitrypsin containing E342K mutation (ATZ mutant) fused to blue fluorescence protein (BFP) tag protein, an HA tag and the eleventh β-strand of GFPDepositorInsertalpha-1-antitrypsin (SERPINA1 Human)
TagsGFP11, HA, and TagBFPExpressionBacterial and MammalianMutationE342K (ATZ mutant)Available sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry_LD 0_CS A_tTA-BFP
Plasmid#58873PurposeMESA target chain with mCherry ectodomain, no linker domain, A cleavage sequence, and tTA-BFP fusionDepositorPublicationInsertMESA target chain with mCherry ectodomain, cd28 transmembrane domain, mutated TEV cleavage sequence (A in P1')
UseAAVTagsEBFPExpressionMammalianPromoterCMVAvailable sinceNov. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
EK0396 BFPmut-stop-t70587 (pEAQ)
Plasmid#191171PurposeEK0208 in plant-expressable format; Trigger 1 in 3' UTR of an inactive BFPDepositorInsertt70587 (plant)
ExpressionPlantMutationWTAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-HA-TagBFP
Plasmid#120910PurposeExpresses BFP tagged Ptch1-BDepositorInsertPtch1 (Ptch1 Mouse)
TagsHA and TagBFPExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291PromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHage2-EF1a-TagBFP-hCoilin
Plasmid#182589Purposeexpresses bfp-hcoilin in mammalian cellsDepositorAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AID-BFP-loxP_myo2_neoR
Plasmid#194054PurposeDual-selection cassette plasmid for knocking-in AID-BFP into the C. elegans genomeDepositorAvailable sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only