We narrowed to 7,278 results for: cas9 plasmid
-
Plasmid#155092Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMB2 (core essential gene)DepositorInsertPSMB2_sgRNA_1 (PSMB2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pV1200
Plasmid#111429PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-p65-HSF1-Blast
Plasmid#192652Purpose3rd generation lenti vector encoding scFV-p65-HSF1 with 2A Blast resistance markerDepositorInsertscFv-p65-HSF1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-mCherry-P2A-Cre-WPRE (AAV1)
Viral Prep#107312-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-mCherry-P2A-Cre-WPRE (#107312). In addition to the viral particles, you will also receive purified AAV-hSyn-mCherry-P2A-Cre-WPRE plasmid DNA. hSyn-driven expression of mCherry and Cre (physically separate). These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherry (physically separate, not a fusion protein)Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-CT
Plasmid#112876PurposeAAV inverted terminal repeat based vector plasmid encoding the C-terminal half of nCas9DepositorInsertABE-CT
UseAAVAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TUBA1B
Plasmid#207763PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of TUBA1B for knock-in.DepositorInsertsgRNA Targeting N-terminus of TUBA1B (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-CENPA
Plasmid#227282PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CENPA for knock-in.DepositorInsertsgRNA Targeting N-terminus of CENPA (CENPA Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-CETN2
Plasmid#227291PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CETN2 for knock-in.DepositorInsertsgRNA Targeting N-terminus of CETN2 (CETN2 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-H3C2
Plasmid#207780PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of H3C2 for knock-in.DepositorAvailable SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKC152_Lenti_tetoff_PABP-INT_EF1a_EGFP
Plasmid#250950PurposeA lentiviral vector express PABP-INT fusion protein under a Tetoff system. Contains EGFP as selection marker.DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-22
Plasmid#140904PurposeMarkerFree plasmid for integration of pADH1-PCP-Mxi1 into site X-4DepositorInsertPCP-Mxi1
PromoterADH1Available SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGH224_sgRNA_2xMS2_Puro
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS143
Plasmid#122377PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJHCi
Plasmid#251729Purposebroad-host-range plasmid for CRISPR interference; inducible dCas9; sgRNA expression from methanotroph constitutive promoterDepositorInsertdCas9
UseCRISPRAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMM765
Plasmid#133602PurposePart Plasmid for dCas9 NLS Stop, Part 3(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM766
Plasmid#133603PurposePart Plasmid for dCas9 NLS Stop, Part 3b(coding sequence)DepositorInsertdCas9 NLS Stop
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-SpRY
Plasmid#161520PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zSpRYCas9-NLS without promoterDepositorInsertzSpRYCas9
UseCRISPR; Gateway compatible zsprycas9 entry cloneTags3X FLAG, NLS and NLSExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only