We narrowed to 14,138 results for: eng
-
Plasmid#170829PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG eGFP NLS
Plasmid#170830PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locusDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALENTagsNLSExpressionMammalianPromoterCAGAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE)
Plasmid#214878PurposeLentiviral vector encoding RfxCas13d targeting SURF1 guide arrayDepositorInserthU6-crSURF1-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7556 pHR (hU6-crCD46-EFS-PuroR-WPRE)
Plasmid#214880PurposeLentiviral vector encoding RfxCas13d targeting CD46 guideDepositorInserthU6-crCD46-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-NLS-PTEN
Plasmid#206984PurposeLentiviral vector for expressing doxycyclin-inducible cDNA of PTEN with NLSDepositorAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEA02
Plasmid#172193PurposeSuicide vector carrying the site attL of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattL
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA03
Plasmid#172194PurposeSuicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattR
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pIG-648 CTLA4int1-CTLA4-GFP-SV40
Plasmid#186123PurposeCTLA4 gene knockinDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H21
Plasmid#170335PurposeCFP(ST)_EPAC full length_Y(UST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
(365) pcDNA3.1(+)-HA-nUbc-(EAAAK)4-OGT(4)
Plasmid#168188PurposeHA-tagged Ubc6E nanobody fused to a truncated OGT of 4 TPRsDepositorInsertHA-nUbc6E-(EAAAK)4-OGT(4)
TagsHA-TagExpressionMammalianPromoterT7/CMVAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ217
Plasmid#162685PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating two point mutations, G489C and S530C, to introduce a 6th disulfide bond (from PETase).DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), with mutations to introduce a 6th disulfide bond from PETase
TagsHisExpressionBacterialMutationG489C, S530C; codon optimized for E. coli K12PromoterT7/lacAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c2X-ORF24-NTD
Plasmid#138465PurposeExpresses MBP-tagged ORF24-NTD in bacteriaDepositorInsertORF24 (ORF24 KSHV (HHV-8))
TagsMBPExpressionBacterialMutationAmino acids 1-201PromotertacAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>m2a(silent)-srt-his
Plasmid#124807PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.DepositorInsertMurine IgG2a (Fc silent)
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationL234A/L235A/N297AAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-191084-gp160
Plasmid#123234PurposeMammalian expression plasmid for Env from the 191084 B7-19 HIV-1 isolateDepositorInsertHIV-1 (191084 B7-19) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD14
Plasmid#112822PurposepSMF2 with 14 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repeā¦PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
AAEL007584-Cas9
Plasmid#100706PurposeThe promoter of AAEL007584 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL007584-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL007584 and Opie2Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSN25
Plasmid#100110Purposeexpresses a chimeric SOX2-repressor fusionDepositorUseLentiviralExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only