We narrowed to 14,052 results for: crispr grnas
-
Plasmid#230081PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLentiCRISPR v2-sgCBS-2
Plasmid#230082PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-1
Plasmid#230083PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone1
Plasmid#162125PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone2
Plasmid#162126PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMK312 (TOP2A CRISPR)
Plasmid#140654PurposeTOP2A tagging CRISPRDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p8103 LentiCRISPR v2 sgNT-2
Plasmid#163313PurposeExpresses Cas9 and a non-targeting control guide RNADepositorInsertsgNT-2
UseCRISPR and LentiviralPromoterU6Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone3
Plasmid#162127PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg2
Plasmid#218531PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg1
Plasmid#218530PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8115 LentiCRISPR v2 sgPTPN14-3
Plasmid#163314PurposeExpresses Cas9 and a human PTPN14-targeting control guide RNADepositorInsertsgPTPN14-3
UseCRISPR and LentiviralPromoterU6Available SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC2
Plasmid#191857PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: ATCATG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC6
Plasmid#191861PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: CCTAGT) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only