169,450 results
-
Plasmid#122844PurposeC-terminal EGFP tag. Gateway destination vector for mammalian expression.DepositorTypeEmpty backboneUseGateway destinationTagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pYAL_HLA-A2_MART1
Plasmid#171177PurposeDisplays MART-1 peptide in HLA-A*02 as a single-chain trimerDepositorInsertMART1_HLA-A2*01 single-chain trimer fusion
ExpressionBacterial and YeastPromoterGAL1Available SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ihSyn1-DIO-tTA (AAV1)
Viral Prep#99121-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-ihSyn1-DIO-tTA (#99121). In addition to the viral particles, you will also receive purified pAAV-ihSyn1-DIO-tTA plasmid DNA. Cre-dependent expression of the tet-off transactivator from an inducible synapsin promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterihSyn1Available SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC-CANTHipi
Plasmid#53301PurposeContains crtE, idi, crtI, crtY, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and a crtO cDNA of Haematococcus pluvialis fused to a Trc promoter. Produces canthaxanthin in E. coli.DepositorInsertcrtO
UseLow copy number bacterial cloning vectorTags6HisPromoterTrcAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSL1119 (pDonor)
Plasmid#160732PurposeMini-transposon donor plasmid for V. cholerae CAST system. pUC19 vector backbone.DepositorInsertVchCAST donor DNA (Mini-Tn)
ExpressionBacterialPromoterN/AAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtS1R1R2B2
Plasmid#160882PurposeExpression of N. tabacum Rubisco small subunit (rbcS-S1), Rubisco chaperone protiens rbcX, raf1, bsd2 and raf2 in E. coli.DepositorInsertrbcS-S1, rbcX, raf1, raf2, bsd2
ExpressionBacterialPromoterrbcS-S1: T7, chaperones: T7Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTW334e
Plasmid#237315Purposeexpresses A. thaliana Cpn60α Cpn60β Cpn20 Raf1 Raf2 RbcX Bsd2DepositorInsertA. thaliana Cpn60α Cpn60β Cpn20 Raf1 Raf2 RbcX Bsd2
ExpressionBacterialAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pN251
Plasmid#188471PurposeLentiviral construct encoding doxycycline-inducible enCas12a-HF (via TetON3G)DepositorInsertenCas12a-HF (gift from Dr. Keith Joung)
UseLentiviralExpressionBacterial and MammalianAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Hygro DEST (w117-1)
Plasmid#17454Purpose3rd gen lentiviral Gateway destination vector, expression, CMV promoter, HygroDepositorTypeEmpty backboneUseLentiviral; Destination vectorExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(Hygro) TagBFP-hNucleolin
Plasmid#182592Purposeexpresses bfp-hNucleolin in mammalian cellsDepositorAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-MEG3
Plasmid#44727DepositorAvailable SinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAM1
Plasmid#60487PurposeThis plasmids is a modular mini-Tn5 vector that could be used to generate random mutagenesis libraries or to insert heterologous DNA into a target genomeDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-DDX3X
Plasmid#116730PurposeLentiviral expression of DDX3XDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
HDAC8 Flag
Plasmid#13825DepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eGFP-uTEV3
Plasmid#234320PurposeMammalian expression of uTEV3 tagged with an eGFP markerDepositorInserteGFP-uTEV3
UseAAVTagseGFPExpressionMammalianMutationMutations respective to the wild type TEV: S219V …PromoterCMVAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-GFP
Plasmid#110834Purposepositive control for GFP expressionDepositorInsertelongation factor 1alpha binding sequence (EFS) at GFP promoter region
UseLentiviralExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
SGEP
Plasmid#111170PurposemiR-E (miR-30 variant)-based RNAiDepositorInsertmiR-E (miR-30 variant)
UseLentiviralMutationWTPromoterSFFVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Kif5c-Myc
Plasmid#186616PurposeThird generation lentiviral vector expressing Kinesin Heavy Chain 5 isoform C fused to Myc tagDepositorInsertKinesin Heavy Chain isoform 5c (KIF5C Human)
UseLentiviralTagsMyc tagExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
V5-LOV-Turbo-ERM
Plasmid#199664Purposeexpresses LOV-Turbo on the mammalian ER membrane, lentiviral vectorDepositorInsertLOV-Turbo
UseLentiviralTagsSEC61B and V5ExpressionMammalianPromoterTRE3GAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only