We narrowed to 7,526 results for: tet
-
-
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-STU-Lb
Plasmid#138102PurposeGolden Gate entry vector for 3rd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-STU-Lb
Plasmid#138099PurposeGolden Gate entry vector for 2nd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV_TRET_hNgn2_UBC_Puro
Plasmid#61474Purpose3rd generation lentiviral vector; TetON promoter driving human Ngn2; constitutive expression of Puromycin selection markerDepositorInsertsUseLentiviralAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1658-dCas9-EGFP
Plasmid#51023PurposeTemplate for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system)DepositorInsertdCas9 fuse to EGFP
UseCRISPR and RetroviralTagsEGFPExpressionMammalianPromoterMSCV LTR promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCathepsin L
Plasmid#11250PurposeMammalian expression of human cathepsin LDepositorHas ServiceCloning Grade DNAInsertcathepsin L (CTSL Human)
TagsC9 (GTETSQVAPA)ExpressionMammalianAvailable SinceMay 25, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
FUW-Sox10
Plasmid#36978DepositorAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCS2-UTX-F-MT2
Plasmid#40619PurposeExpression of enzyme-dead UTX in mammalian cellsDepositorInsertUTX (KDM6A Human)
Tags6xMyc and FlagExpressionMammalianMutationchanged Histidine 1146 and Glutamic Acid 1148 to …PromoterCMVAvailable SinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
Hygro-Cas9 donor
Plasmid#86883PurposeDonor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus with hygromycin selectionDepositorInserthSpCas9
UseCRISPRTags3xFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (5B)
Plasmid#85498PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the Mj 3NY (5B) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32H H70C D158S I159A L162RPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCathepsin S
Plasmid#11251PurposeMammalian expression of human Cathepsin SDepositorAvailable SinceAug. 4, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
pB-TAG-NICD
Plasmid#130934PurposePiggyBac vector for DOX-inducible human NICD-IRES-EGFP expression in mammalian cellsDepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSW003-PpsbA-mNeonGreen
Plasmid#205019PurposeBroad host-range bacterial expression vector with constitutive PsbA promoter; mNeonGreen (codon optimized for P. fluorescens)DepositorInsertmNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPpsbAAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-tTA
Plasmid#178516PurposeAAV vector for Cre recombinase dependent tetracycline-controlled transactivator (tTA) expressionDepositorInserttTA
UseAAVExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHPHS232
Plasmid#228356PurposeLanding pad with Bxb1 attP_wildtype site, Dox-inducible BFP-iCasp9-Blasticidin, CMV-driven rtTA3, T2A-neomycin for HDR into AAVS1 locusDepositorInsertsmTagBFP2
Reverse tetracycline transactivator 3
neo
TagsBlasticidin S deaminase and iCasp9ExpressionMammalianPromoterTRE3GV and gene trapAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP-Lck-PinkFlamindo
Plasmid#228394PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVPromotermGFAPAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only