We narrowed to 15,752 results for: LIS
-
Plasmid#233217PurposeMammalian epression of anti-amyloid-β 40/42 nanobody (R3VQ) with a sortase tag for direct dye conjugation.DepositorInsertAnti-amyloid-β 40/42 nanobody (R3VQ)
TagsSortase tag, His tagExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIG-828_HA-GD2-28z_CAR_BATF_Retroviral
Plasmid#207505PurposeThis plasmid can be used to generate retrovirus.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_FUS_FLI1
Plasmid#205822PurposeExpress mEGFP-tagged fusion protein, FUS_FLI1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_016-sgATF4-1
Plasmid#202455PurposeExpression of a guide RNA targeting ATF4DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chr7_Centromere-Targeting_gRNA
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
p300 core-dCas9-CBP core
Plasmid#179559Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
AAV_Nanog HMEJ donor
Plasmid#97321PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Nanog. AAV backbone.DepositorInsertNanog HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Sox2 HMEJ donor
Plasmid#97322PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Sox2. AAV backbone.DepositorInsertSox2 HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag RdgBbeta (long form) splice variant 1
Plasmid#58275Purposemammalian expression of human RdgBbeta splice variant 1DepositorAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV:eGFP-p2A-HA-GPR151(p.Arg95Ter)
Plasmid#190134Purposeexpresses eGFP-p2A-HA-GPR151 (pArg95Ter variant) in mammalian cellsDepositorInserteGFP-p2A-HA-GPR151(p.Arg95Ter)
UseLentiviralTagsHA, eGFP, and p2AExpressionMammalianMutationp.Arg95Ter mutationPromoterCMVAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Myc-gamma2S/deltaIL
Plasmid#119730PurposeGABAA receptor expression (chimeric rat gamma2 short subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat delta subunit) Myc-tag near N-terminusDepositorTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBsVchCAST
Plasmid#203812PurposeExpression of CRISPR-associated transposases, shuttle vector for Bacillus subtilis / E. coliDepositorInsertVchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC
UseCRISPRExpressionBacterialAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPD0035_CROPseq-CAR-Puro_CD19-28z
Plasmid#242983PurposeCD19-28z FMC63 CARDepositorInsertCD19-28z FMC63 CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
COX8mls-Flag-APEX2-SOPP3
Plasmid#229075PurposeExpresses APEX2-SOPP3 in the mitochondrial matrixDepositorInsertExpress APEX2-SOPP3 in the mitochondrial matrix (APEX2 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only