We narrowed to 13,244 results for: BASE;
-
Plasmid#163769PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette under the pH promoter.DepositorInsertno insert
Tagsno tagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP790_αGCN4-EZH2-FL-CO
Plasmid#211784PurposeSunTag counterpart binding domain, aGCN4, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertSnoopCatcher-KRAB
Tags2xOLLASExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
KJ901: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGIB-HA-hTCAB1
Plasmid#167460PurposeRetroviral expression of HA-TCAB1 (WDR79) in mammalian cellsDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
139H2_LC
Plasmid#206202PurposeFor recombinant expression of the light chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells.DepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-rac2-guides
Plasmid#168241Purpose"neutrophil specific GFP with ubiquitous rac2 sgRNAs"DepositorInsertrac2 sgRNAs
UseCRISPRAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_IL1RN
Plasmid#64151PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIneoLuc-PP1A
Plasmid#128348PurposeVector for LUMIER assayDepositorAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega2_Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1678)
Plasmid#160642PurposeModule for the dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertGRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
TC1092
Plasmid#164879PurposeCMV-dcas13d-NLS-ADARdd- mCherryDepositorInsertdcas13d-ADARdd
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1 PA-mCit
Plasmid#113443PurposeProteinA-mCitrine control expression vectorDepositorInsertProteinA-mCitrine
ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_IL1RN
Plasmid#64142PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4_IL1RN
Plasmid#64152PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
p1.1-Tr2-eGFP
Plasmid#162782PurposeFluorescent reporter for protein expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only