Skip to main content

We narrowed to 174,943 results for: Mal

Showing: 6921 - 6940 of 174943 results
  1. LUC01 (L/Sec/P)

    Plasmid
    #112144
    Purpose
    Mammalian expression vector to test the effect of substituting selenocysteine for Cys on luciferase enzyme activity
    Depositor
    Insert
    Luciferase coding region with Cysteine 258 mutated to selenocysteine (U) and wild-type PHGPx SECIS in the 3' UTR (Gpx4 Photinus pyralis, Rat)
    Expression
    Mammalian
    Mutation
    Cysteine 258 mutated to selenocysteine (U)
    Available Since
    July 6, 2018
    Availability
    Academic Institutions and Nonprofits only
  2. LUC05 (L/Cys/P)

    Plasmid
    #112146
    Purpose
    Mammalian expression vector to test the effect of substituting selenocysteine for Cys on luciferase enzyme activity
    Depositor
    Insert
    Luciferase coding region with wild type Cysteine 258 and wild-type PHGPx SECIS in the 3' UTR (Gpx4 Photinus pyralis, Rat)
    Expression
    Mammalian
    Mutation
    none
    Available Since
    July 6, 2018
    Availability
    Academic Institutions and Nonprofits only
  3. pcDNA3-HCMVgO-sfGFP (TB40/E)

    Plasmid
    #136451
    Purpose
    Mammalian expression plasmid for HCMV glycoprotein O (TB40/E strain) fused to superfolder GFP
    Depositor
    Insert
    glycoprotein O (UL74 Human betaherpesvirus 5)
    Tags
    Gly/Ser-rich linker (GGSGGSGSGG) (includes BamHI …
    Expression
    Mammalian
    Mutation
    Codon-optimized for human cell expression.
    Promoter
    CMV
    Available Since
    July 9, 2020
    Availability
    Academic Institutions and Nonprofits only
  4. pcDNA3-HCMVgH-8his (Merlin)

    Plasmid
    #136447
    Purpose
    Mammalian expression plasmid for HCMV glycoprotein H (Merlin strain) extracellular domain with 8his purification tag
    Depositor
    Insert
    glycoprotein H (UL75 Human betaherpesvirus 5)
    Tags
    Short GGSG linker and 8his tag
    Expression
    Mammalian
    Mutation
    Extracellular domain (a.a. 1-716). Codon-optimize…
    Promoter
    CMV
    Available Since
    July 9, 2020
    Availability
    Academic Institutions and Nonprofits only
  5. pcDNA3-His:CRY2:nls:VPR

    Plasmid
    #135989
    Purpose
    Expresses the CRY2 blue light-inducible domain fused to the VPR transcriptional activation domain in mammalian cells
    Depositor
    Inserts
    CRY2 domain fused to the VPR activation domain
    CRY2 domain fused to the VPR activation domain
    Tags
    His
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    Feb. 4, 2020
    Availability
    Academic Institutions and Nonprofits only
  6. pJZC116

    Plasmid
    #62344
    Purpose
    sgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFP
    Depositor
    Inserts
    sgRNA + 2x MS2 (wt+f6) binding module
    MCP-VP64
    Use
    Lentiviral
    Tags
    VP64
    Expression
    Mammalian
    Mutation
    Targets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGC
    Promoter
    CMV and U6
    Available Since
    April 2, 2015
    Availability
    Academic Institutions and Nonprofits only
  7. pFRLuc-CoV2-delStem1

    Plasmid
    #177616
    Purpose
    Dual luciferase reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. 3-nucleotide deletion in Stem 1 (negative control).
    Depositor
    Insert
    SARS-CoV-2 FSE
    Use
    Luciferase
    Expression
    Mammalian
    Mutation
    3-nucleotide (UAC) deletion in Stem 1
    Available Since
    Dec. 10, 2021
    Availability
    Academic Institutions and Nonprofits only
Showing: 6921 - 6940 of 174943 results