We narrowed to 13,244 results for: BASE
-
Plasmid#176095PurposeConstitutively active, nuclear localized Rac1DepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-hA3A-eBE-Y132D
Plasmid#113429PurposeExpresses hA3A-eBE-Y132D in mammalian cellsDepositorInserthA3A-eBE-Y132D (APOBEC3A S. pyogenes and Bacteriophage PBS2, Human)
UseCRISPRExpressionMammalianMutationhAPOBEC3A_Y132DPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRD395
Plasmid#163102PurposeExpression of mCherry_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmCherry_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b(K72A)
Plasmid#23258DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160)
Plasmid#75412PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19DepositorInsertRenilla / P19
UseLuciferase and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO101: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-Dnmt3a3L
Plasmid#121833PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP4-WPRE
Plasmid#193919PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertCCre-MBP4
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP5-WPRE
Plasmid#193918PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertNCre-MBP5
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLN193 (SSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe))
Plasmid#105210PurposeModule 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 3 intron - see PMID: 29056342 for detailed information)DepositorInsertSSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe)
UseSynthetic BiologyExpressionMammalianAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLD-hygro-EnVM
Plasmid#24590DepositorInsertGateway(TM) cassette
UseLentiviralTagsVMExpressionMammalianAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 V572I
Plasmid#139321PurposePlasmid expressing a sgRNA to introduce BRCA2 V572I using base editingDepositorInsertsgRNA to insert BRCA2 V572I using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3-MTS-CCDB-N136-RsDddA-A-UGI-PURO
Plasmid#205463PurposeA backbone containing a RsDddA fragment A for constructing mitochondria-targeted RsDdCBE expression plasmidDepositorInsertMTS; N136; ccdb; RsDddA-A; UGI
ExpressionMammalianAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-MTS-CCDB-N136-RsDddA-C-UGI-PURO
Plasmid#205465PurposeA backbone containing a RsDddA fragment C for constructing mitochondria-targeted RsDdCBE expression plasmidDepositorInsertMTS; N136; ccdb; RsDddA-C; UGI
ExpressionMammalianAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
p47phox-PX (1-122)
Plasmid#119124PurposeBacterial expression of human phox homology (PX) domain, p47phox-PX (1-122)DepositorInsertp47phox-PX (1-122)
TagsGSTExpressionBacterialPromotertacAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX11-PX (7-167)
Plasmid#119092PurposeBacterial expression of human phox homology (PX) domain, SNX11-PX (7-167)DepositorAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only