We narrowed to 10,839 results for: yeast
-
Plasmid#173442PurposepRS316-mNeonGreen-CBP-2XFLAG-HYGB, contains C. neoformans optimized mNeonGreen and HYG marker for use as PCR templateDepositorInsertmNeonGreen-CBP-2XFLAG-HYGB
TagsCBP-2xFLAGExpressionBacterial and YeastAvailable sinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFA6a-mCherry-sfGFP-kanMX (pMaM17)
Plasmid#173452PurposeContains mCherry-sfGFP tandem fluorescent protein timerDepositorInsertmCherry-sfGFP-ADH1ter
ExpressionYeastPromoterno promoterAvailable sinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_mScarlet_CLASP_RGS2membrane
Plasmid#133086PurposePlasmid contains mScarlet with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-mScarlet-yeLANS). CLASP modulates nuclear localization of mScarlet in response to blDepositorInsertmScarlet-CLASP
ExpressionBacterial and YeastAvailable sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGWKS7
Plasmid#139414PurposeFluoroescent marker for use in Cryptococcus neoformans. Contains a codon optimised mRuby3 marker.DepositorInsertmRuby3
ExpressionYeastPromoterTEF1Available sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENO1-iRFP-NATr
Plasmid#129731PurposeIntegration plasmid to overexpress iRFP in Candida albicansDepositorInsertiRFP-Candida albicans codon-optimized
ExpressionYeastPromoterENO1 from Candida albicansAvailable sinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHIPH4
Plasmid#117685PurposeHansenula polymorpha expression plasmidDepositorInsertAlcohol Oxidase promoter
ExpressionYeastPromoterAlcohol OxidaseAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTG1*-thymosinB-8His
Plasmid#111147PurposeExpresses human gamma-actin (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag.DepositorInsertactin gamma 1 (ACTG1 Human)
UsePichia pastoris integration vectorTagsThymosin beta and a His-tagExpressionYeastMutationcodon-optimised for expression in Pichia pastorisPromoterAOX1Available sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFA6-mTFP1-KanMX6
Plasmid#69851PurposeC-terminal tagging with mTFP1 using KanMX6 as a selection marker in S. cerevisiae.DepositorInsertmTFP1
ExpressionYeastAvailable sinceApril 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPMVAu8
Plasmid#98297PurposeEnhancing the upper-part mevalonate pathway; overexpressing codon-optimized Enterococcus faecalis mevalonate pathway genes under the control of consitutive promoters.DepositorInsertPRPL4A-EfmvaS-TEFM1-PRPL15A-EfmvaE -TEBS1
ExpressionYeastAvailable sinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYC56
Plasmid#63910PurposeRecipient integrative vector to construct mCherry tagged fusionsDepositorTypeEmpty backboneTagsmCherryExpressionYeastAvailable sinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFA6a-mRFP-ura4MX6
Plasmid#49183Purposegenomic mRFP tagging in S. pombeDepositorTypeEmpty backboneTagsmRFPExpressionYeastAvailable sinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-12Pk-kanMX6
Plasmid#49176Purposegenomic 12Pk epitope tagging in S. pombeDepositorTypeEmpty backboneTags12PkExpressionYeastAvailable sinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRSII314
Plasmid#35451DepositorTypeEmpty backboneUseYeast centromere vectorPromoterNoneAvailable sinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDS282
Plasmid#34983DepositorInsertcpPDZ–mCherry
ExpressionYeastPromoterTEFAvailable sinceMarch 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-KanMX6-Purg1-3FLAG
Plasmid#19354DepositorInserturg1 promoter
ExpressionYeastAvailable sinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
pE5n
Plasmid#17459Purposemodified pENTR vector for N-terminal ECFP tag fusion with your gene of interestDepositorPublicationTypeEmpty backboneUseModified gateway entry vectorTagsECFPExpressionBacterial, Insect, Mammalia…Available sinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pL-rpb1-E1103G
Plasmid#10989DepositorInsertrpb1-E1103G (RPO21 Budding Yeast)
ExpressionBacterial and YeastMutationMutation 3308 A to G in the RPB1 ORF resulting in…Available sinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only