We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#143486PurposeExpresses BE-PAPAP in yeast cellsDepositorInsertBE-PAPAP
UseCRISPRExpressionYeastMutationspCas9(D10A)PromoterGalLAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR3-SV40-puro
Plasmid#240537PurposeLentiviral eBAR3 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR3
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR2-SV40-puro
Plasmid#240536PurposeLentiviral eBAR2 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT7R-7xsfGFP11-HA-HDR-donor
Plasmid#221818PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT7R coding frameDepositorInsert7xGFP11-HA donor with 5-HT7R homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donor
Plasmid#221832PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1AR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donor
Plasmid#221833PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT2BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donor
Plasmid#221837PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LIG4 HAL-T2A-GFP-SV40pA-HAR
Plasmid#225357PurposeThis plasmid serves as a template for homologous DNA recombination at the LIG4 gene to knock out the DNA ligase 4 protein using the SelectRepair knockout GFP approach.DepositorInsertT2A-GFP-SV40pA
UseCRISPRAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LIG4 HAL-T2A-HYG-SV40pA-HAR
Plasmid#225358PurposeThis plasmid serves as a template for homologous DNA recombination at the LIG4 gene to knock out the DNA ligase 4 protein using the hygromycin B SelectRepair knockout approach.DepositorInsertT2A-HYG-SV40pA
UseCRISPRAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LIG4 HAL-T2A-NEO-SV40pA-HAR
Plasmid#225359PurposeThis plasmid serves as a template for homologous DNA recombination at the LIG4 gene to knock out the DNA ligase 4 protein using the neomycin SelectRepair knockout approach.DepositorInsertT2A-NEO-SV40pA
UseCRISPRAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Setd2CD-CatMut
Plasmid#235588PurposeDox-inducible expression of control catalytic-mutant Setd2 CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV302
Plasmid#204973PurposeAMA1 plasmid with Aspergillus optimized Mad7 and nat1 resistance markerDepositorInsertsMad7
nat1
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV299
Plasmid#204967PurposeAMA1 plasmid with Aspergillus optimized Mad7 and argB selection markerDepositorInsertsMad7
argB
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and native pro…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-2xMS2
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only