We narrowed to 16,609 results for: grna
-
Plasmid#221705PurposeCas9 targeting plasmid with gRNA specific for LRR1 N-terminusDepositorInsertTGTAGCTTCATCTCGCCCAA
UseCRISPRPromoterChicken Beta-actinAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-MYADM
Plasmid#235245PurposeEncodes gRNA for human MYADMDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gControl_dTet_IRES_mTurquoise2
Plasmid#189799PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-AtpU6-29
Plasmid#160219PurposeAtpU6-29 Golden Gate level 0 piece to express gRNAsDepositorInsertpAtU6-29 promoter
UseGolden gate level 0 piece to express grnasAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Grin1-smFP-V5 KI
Plasmid#183439PurposeFlpON knock-in for GluN1-smFP-V5 (amino acid position: A20)DepositorInsertgRNA and smFP V5 donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-87
Plasmid#163085PurposeMarkerFree plasmid for integration of pADH1-MCP-VPR into site XI-5DepositorInsertVPR
TagsMCPExpressionYeastPromoterADH1Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-pleCopyCatcher
Plasmid#174061PurposeCopyCatcher insertion donor for the pale locusDepositorInsertPale (Pale Fly, Synthetic)
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
S1_AscI_V5-gateway_Bsu36I
Plasmid#128467Purposedestination vector with N-terminal V5 tagDepositorInsertdestination vector with N-terminal V5 tag
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S2_AscI_HA-gateway_Bsu36I
Plasmid#128468Purposedestination vector with N-terminal HA tagDepositorInsertdestination vector with N-terminal HA tag
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC-U61-SapI
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN220
Plasmid#91681PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN221
Plasmid#91682PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN154
Plasmid#91683PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX203
Plasmid#89267PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02DepositorInsertOsDEP1-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX202
Plasmid#89266PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA01DepositorInsertOsDEP1-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only