We narrowed to 16,291 results for: grna
-
Plasmid#91074PurposeModule B, Promoter: TaU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterTaU3Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgLacZs
Plasmid#171185PurposeExpresses sgRNADepositorInserthU6-sgLacZ1-hU6-sgLacZ2
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC583
Plasmid#62314PurposesgRNA with 2x MS2 for yeast cellsDepositorInsertsgRNA + 2x MS2 binding module
ExpressionYeastPromoterSNR52Available SinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-crRNA4n96
Plasmid#123640PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertcrRNA scaffold 4n96
ExpressionMammalianAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
1098A=TI-pgSIT[sxl,bTub,Hasp70Bb-Cas9]
Plasmid#149426PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel sxl and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[Sxl, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_INT
Plasmid#68438PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPN217
Plasmid#91676PurposeExpress sgRNA targeting human TLE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[P4-P6(3xPP7)]
Plasmid#68432PurposeTransient expression in mammalian cells of an "INT" construct_bearing P4_P6 (internally appended with three PP7 stem-loops), targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing P4_P6 (internally appended with three PP7 stem-loops)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC593
Plasmid#62319PurposesgRNA with MS2-PP7 for yeast cellsDepositorInsertsgRNA + MS2-PP7 RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC572
Plasmid#62318PurposesgRNA with 1x com for yeast cellsDepositorInsertsgRNA + 1x com RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2519
Plasmid#91076PurposeModule B, Promoter: OsU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterOsU3Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN022
Plasmid#91668PurposeExpress sgRNA targeting human SHANK3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN021
Plasmid#91667PurposeExpress sgRNA targeting human SHANK3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-crRNA1
Plasmid#123639PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertcrRNA scaffold 1
ExpressionMammalianAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC548
Plasmid#62316PurposesgRNA with 1x PP7 for yeast cellsDepositorInsertsgRNA + 1x PP7
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
TU#1806_CRISPR_unc-73_exon21
Plasmid#82360Purposeto create unc-73E null alleleDepositorInsertCas9 and sgRNA against unc-73 exon21 (unc-73 Nematode)
UseCRISPRExpressionWormPromoterU6Available SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN216
Plasmid#91675PurposeExpress sgRNA targeting human TLE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only