We narrowed to 4,733 results for: GCA
-
Plasmid#36297DepositorInsertshRNA of beta-catenin-1 (CTNNB1 Human)
UseLentiviral and RNAiTagsIRES-RFP-PuroExpressionMammalianPromoterTetO-H1Available SinceAug. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HtrA2-EGFP
Plasmid#14121DepositorAvailable SinceMarch 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-gRNA-Actb1216
Plasmid#155368PurposePspCas13b guide RNA positioned 8bp 5' of Actb 1216 for targeted m6A RNA methylationDepositorInsertPspCas13b gRNA targeting Actb 1216
UseCRISPRExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGPTVII-Bar-U-MatryoshCaMP6s
Plasmid#100024PurposePlant expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting cpEGFP.DepositorInsertMatryoshCaMP6s
ExpressionPlantPromoterAtUBQ10Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #2
Plasmid#136585PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Actb KI #2
Plasmid#139666PurposeEndogenous tagging of β-actin: N-terminal (amino acid position: before startcodon)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJYS2cm_crtYf
Plasmid#85543PurposeConstitutive transcription of crRNA of crtYf, Chloramphenicol resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA2.1
Plasmid#64117PurposeVector for expression of St1 sgRNA2.1 in mammalian cellsDepositorInsertSt1 sgRNA2.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mTubb3
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMCB306
Plasmid#89360PurposesgRNA expression vector with GFP, puromycin resistance, BlpI+BstXI cloning sitesDepositorInsertGFP, puromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXL004-ishRNA-scramble
Plasmid#36311DepositorInsertshRNA of scramble
UseLentiviral and RNAiTagsEF1a-TetR-IRES-RFP-PuroExpressionMammalianPromoterTetO-H1Available SinceJuly 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shLKB1-Hu
Plasmid#61242PurposeLentivirus expressing shRNA to human LKB1DepositorInsertLKB1 (STK11 Human)
UseLentiviralAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only