We narrowed to 18,545 results for: BASE;
-
Plasmid#119093PurposeBacterial expression of human phox homology (PX) domain, SNX12-PX (1-162)DepositorAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pyr pUAST-HA
Plasmid#69768PurposePyramus (FGF8-like-2) Ligand in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPyramus (FGF8like-2) (pyr Fly)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutation241T amino acid insertion compared to reference s…Promoterhsp70 promoterAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
PA-RL-BAD
Plasmid#78859PurposeDULIP positive control (bait) for assay establishmentDepositorInsertBCL2 associated agonist of cell death (BAD Human)
UseExpression vectorTagsProtein A, Renilla luciferaseExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti GW-mCit-PA
Plasmid#113457PurposeLentiviral ProteinA-mCitrine Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseLentiviralTagsmCitrine-ProteinAExpressionMammalianPromoterhUbCAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
JG674: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X1)
Plasmid#104568PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to one DmrA domainDepositorInsertdLbCpf1(D832A)-DmrA(x1)
Tags3x FLAG, 3x HA, and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 HA-ECL4 (NT935)
Plasmid#49065PurposeExpresses human NKCC1 mutant with HA tag inserted into extracellular loop #4 and N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutation2xHA epitope in ECL4 inserted at aa574 in hNKCC1 …PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLN484 (FuGW-S(cMYC)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe)
Plasmid#105192PurposeModule 1 - synthetic promoter cMYC drives self-inhibiting GAD expression (see PMID: 29056342 for detailed information)DepositorInsertS(cMYC)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLN189 (SSX1p-[mK-Ex1]-[miR1-Mv2 intron]-[mK-Ex2]-BS(Pe))
Plasmid#105209PurposeModule 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 2 intron - see PMID: 29056342 for detailed information)DepositorInsertSSX1p-[mK-Ex1]-[miR1-Mv2 intron]-[mK-Ex2]-BS(Pe)
UseSynthetic BiologyExpressionMammalianAvailable SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
JG676: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X2)
Plasmid#104569PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to two DmrA domainsDepositorInsertdLbCpf1(D832A)-DmrA(x2)
Tags3x FLAG, 3x HA, and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Httex1-29Q
Plasmid#84350PurposeExpression of the human Huntingtin Exon1 protein containing 29Q in E.coliDepositorInsertHuntingtin Exon 1 (HTT Human)
TagsN-terminal Ssp intein (His-tagged)ExpressionBacterialPromoterT7Available SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 HA-ECL2 (NT931)
Plasmid#49063PurposeExpresses human NKCC1 mutant with HA tag inserted into extracellular loop #2 and an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutation2xHA epitope in ECL2 inserted at aa398 in hNKCC1 …PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti GW-NL-myc
Plasmid#113455PurposeLentiviral NanoLuc Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseLentiviral and LuciferaseTagsNanoLuc-cmycExpressionMammalianPromoterhUbCAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pST1374-GCN4-H840A
Plasmid#113024PurposeExpresses GCN4-H840A in mammalian cellsDepositorInsertGCN4-H840A (GCN4 S. pyogenes, Budding Yeast)
ExpressionMammalianMutationD839A, H840A, N863APromoterCMVAvailable SinceJuly 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL-CP
Plasmid#65716PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL-CP)DepositorInsert7xTcf, minCMV, 3xNLS, ONL, hCL1-PEST
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Httex1-15Q
Plasmid#84348PurposeExpression of the human Huntingtin Exon1 protein containing 15Q in E.coliDepositorInsertHuntingtin Exon1 (HTT Human)
TagsN-terminal Ssp intein (His-tagged)ExpressionBacterialPromoterT7Available SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-YNL-CP
Plasmid#65714PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-YNL-CP)DepositorInsert7xTcf, minCMV, 3xNLS, YNL, hCL1-PEST
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only