We narrowed to 21,837 results for: SPR
-
Plasmid#176156Purposepreassembled yeast MoClo level-2 backbone with GFP dropout for genomic integration in site XI-2DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDGE655
Plasmid#153253PurposeM1 shuttle vector containing the Solanum lycopersicum U6 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE497
Plasmid#153249PurposeM6E shuttle vector containing the Arabidopsis thaliana U6 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH41
Plasmid#125880PurposeLevel0 Parsley PcUBI4-2 Pol II promoterDepositorInsertLevel0 Parsley PcUbi4-2 Pol II promoter
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJL009
Plasmid#122862PurposeBinary expression vector containing 35S:MS2-SRDX:tRBCS followed by GreenGate A-G sequences for insertion of additional modulesDepositorInsert35S:MS2-SRDX:tRBCS
UseGolden gate compatible plant transformation vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-28
Plasmid#120007PurposeTemplate for C-terminal PCR tagging of mammalian genes (without selection) with 3xHADepositorInsert3xHA
UsePcr templateTags3xHAPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-17
Plasmid#119996PurposeTemplate for C-terminal PCR tagging of mammalian genes (without selection) with mEos4bDepositorInsertmEos4b
UsePcr templateTagsmEos4bPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
BCJJ180
Plasmid#117516PurposeCas9_4 Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_4:GCTT:BsaI
UseCRISPRTags3xFLAG and NLSExpressionPlantAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ157
Plasmid#98413PurposePombe Expression Vector - nmt81 promoter with Sp.ura4 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ174
Plasmid#98421PurposePombe Expression Vector - nmt1 promoter with Sp.lys9 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ190
Plasmid#98428PurposePombe General Purpose Vector - with Sp.ura4 markerDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGCG26
Plasmid#82371PurposeYFP expressed from pJ23119 in the glpK locus with gentamicin resistanceDepositorInsertYFP
PromoterPJ23119Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC548
Plasmid#62316PurposesgRNA with 1x PP7 for yeast cellsDepositorInsertsgRNA + 1x PP7
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (AAV6)
Viral Prep#61592-AAV6PurposeReady-to-use AAV6 particles produced from pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA (#61592). In addition to the viral particles, you will also receive purified pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA plasmid DNA. CMV-driven expression of SaCas9. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX552-hsyn DIO GCaMP8f(with gRNA scaffold)
Plasmid#199580PurposeExpresses GCaMP8f in a Cre-dependent mannerDepositorInsertHis-DIO GCaMP8f
UseAAV, CRISPR, and Cre/LoxTags6xHisExpressionMammalianPromoterhsynAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMB952:PB-CAG-PuroR-nGFP-FLEx-SaCas9-P2A-mCherry-WPRE
Plasmid#168107PurposePiggyBac transposon vector constitutively driving PuroR-eGFP and conditionally expressing S.aureus Cas9 and mCherryDepositorInsertCas9-P2A-mCherry
UseCRISPR and Cre/LoxTagsHAPromoterCAGAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only