We narrowed to 15,169 results for: GRN
-
Plasmid#174701PurposeSmall-molecule controlled base editingDepositorInsertLenti-evoA1-seBEN
UseLentiviralTagsmyc tagPromoterEFS/U6Available SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CRISPR-V2-gYap-2
Plasmid#166482PurposeExpresses spCas9 and a gRNA targeting mouse YapDepositorInsertgRNA for mouse Yap (Yap1 Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 sgRipk4 v3
Plasmid#158048Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Ripk4. NO Cas9DepositorInsertRipk4 sgRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
-
pSECB sgMTHFD2L_1
Plasmid#106306PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_2
Plasmid#106307PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJJR50
Plasmid#75026PurposeU6 promoter driven flipped + extended sgRNA expression vectorDepositorInsertguide RNA, flipped and extended version
UseCRISPRPromoterR07E5.16 (U6)Available SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEN243-EN1953
Plasmid#224546PurposeCas9-2A-puro and sgRNA targeting the first coding ATG of mouse NipblDepositorInsertCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl (Nipbl Mouse)
ExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PXN
Plasmid#227315PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiSF3B1
Plasmid#202446PurposeExpression of a CRISPRi guide targeting SF3B1DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgEp300#1/Cre
Plasmid#173591PurposeExpresses a Ep300-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ep300 (Ep300 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2d#2/Cre
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb4-GFP KI
Plasmid#139663PurposeEndogenous tagging of CaVβ4: C-terminal (amino acid position: H417)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only