We narrowed to 173,969 results for: HTT
-
Plasmid#85707PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with a BFP fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCMV10-RBPJ
Plasmid#84601PurposeMammalian expression of FLAG tagged human RBPJDepositorAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
WN10150
Plasmid#80443PurposeExpresses dead (908A) AsCpf1DepositorInsertnuclease dead (908A) AsCpf1
TagsNLS-3xHAExpressionMammalianMutationnuclease dead (D908A)Available SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
eSrtA(2A-9) pET29b
Plasmid#75145Purposereprogrammed sortase A variant that recognizes alternative substrate LAXTG with high activity and specificityDepositorInsertreprogrammed sortase A variant
Tags6x HisExpressionBacterialMutationS102C A104H E105D K138P K152I N160K K162H T164N K…PromoterT7Available SinceJuly 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGWB404
Plasmid#74798PurposeGateway cloning compatible binary vector for C-terminal fusion with sGFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA AKT1
Plasmid#78778PurposeTo overexpress AKT1 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EZH2-PGK-Puro-IRES-GFP
Plasmid#75125PurposeRetroviral expression plasmid encoding wild type human EZH2DepositorAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS-Int
Plasmid#50000PurposeExpresses the integrase on a suicide plasmidDepositorInsertIntegrase from pMV361
ExpressionBacterialPromoterownAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
alpha catenin conformation sensor
Plasmid#71709PurposeThis alpha catenin biosensor undergoes a change in FRET upon mechanical perturbation of the alpha catenin conformation.DepositorInsertalpha-catenin FRET Sensor
TagsECFP and YPETExpressionMammalianPromoterCMVAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGG-9.47_VP1,3 #2515
Plasmid#74237PurposeModified plasmid with a different backbone that yields higher of AAV-AS vectors. Encodes VP1 and VP3 of AAV9.47DepositorInsertsAAV2 Rep
AAV9.47 VP1
AAV9.47 VP3
UseAAVAvailable SinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-H2B-GFP-2A-oG-WPRE-hGH
Plasmid#74289PurposepAAV vector to express H2B-GFP and oG (optimized Glycoprotein) in a Cre-dependent mannerDepositorInsertH2B-GFP and oG (optimized Glycoprotein)
UseAAVExpressionMammalianMutationchimeric glycoproteinPromoterEf1aAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET15b His6-FKBPF36V
Plasmid#73180PurposeExpressing FKBPF36V protein in washing out shield-1 ligand for FKBPddDepositorAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas9cur
Plasmid#71538PurposeConstitutive expression of Cas9 gene and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli.DepositorInsertsCas9
Plasmid curing system
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-mCherry-LacR-BRCA1
Plasmid#71115Purposemammalian expression of mCherry-LacR-BRCA1 siRNA resistant constructDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHBV-Luc
Plasmid#71414PurposeTo see the activity of HBV transcription using Luciferase assayDepositorInsertHBV core promoter, enhancer I, enhancer II and luciferase
UseLuciferaseExpressionMammalianPromoterHBVAvailable SinceDec. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
Notch1 intracellular domain-pcw107-V5
Plasmid#64622Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5E-mfap4
Plasmid#70052Purpose5' Entry vector containing the zebrafish mfap4 promoter. Used with Gateway Recombination to generate transgenic constructs exhibiting macrophage-restricted expression of transgenes.DepositorInsertmfap4 promoter
UseGateway 5' elementAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141A
Plasmid#69290PurposeGateway entry vector; single gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only