We narrowed to 8,945 results for: aav
-
Plasmid#110135PurposeCre-off expression of GCaMP6sDepositorInsertGCaMP6s
UseAAV and Cre/LoxExpressionMammalianAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Puro-CAG-mNG2(1-10)
Plasmid#206042PurposeRepair template for the integration of a mNG2(1-10) expression cassette into the AAVS1 locus in human cells.DepositorInsertAAVS1 homology arms with SA-P2A-Puro marker and CAG-mNG2(1-10) expression cassette
UseCRISPR and Synthetic Biology; Donor templateExpressionMammalianAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ADP-MCS-FLAG
Plasmid#192360PurposeAdipocyte-specific overexpression of genesDepositorTypeEmpty backboneUseAAVTags3xflagExpressionMammalianPromoteradiponectin promoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-GFP
Plasmid#59170PurposeAAV-mediated expression of Chronos-GFP under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, and AAV5InsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-GRAB_g5-HT3.0
Plasmid#208727PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0 in astrocytesDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0
UseAAVPromoterGfaABC1DAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE3G-CytoTape-FLAG
Plasmid#252514PurposeTimestamp monomer based on CytoTape for encoding time along protein tape recorder for mouse brain in vivo applicationsDepositorInsertCytoTape-FLAG
UseAAVExpressionMammalianPromoterTRE3GAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg2
Plasmid#124857PurposeMutagenesis of Gabrg2DepositorInsertGabrg2 (Gabrg2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-dCas9-KRAB
Plasmid#115545PurposeDoxycycline inducible dCas9-KRAB targeting construct for AAVS1 locusDepositorTypeEmpty backboneTagsHAExpressionBacterial and MammalianPromoterCAGAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-GCaMP6s
Plasmid#105714PurposeCan be used to express GCaMP6s in the presence of Flp recombinase. Can be used to create adeno-associated virus to express Flp-dependent GCaMP6s.DepositorHas ServiceAAV8InsertGCaMP6s
UseAAV; Flp/frtExpressionMammalianPromoterEf1a, Human elongation factor-1 alphaAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iATPSnFR2.A95A.A119L.HaloTag
Plasmid#209661PurposeExpression of iATPSnFR2, low affinityDepositorInsertiATPSnFR2.A95A.A119L.HaloTag
UseAAVMutationA95A.A119LPromoterGFAPAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-MCP-huADARE488QT490A
Plasmid#159922PurposeFusion of MS2 coat protein to Human ADAR2 E488QT490A, under Ef1a promoter, with WPRE. AKA 116v5DepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Chronos-GFP
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJEP221-AAV-RSV-GFP-pA
Plasmid#62919PurposeAAV vector backbone designed to express GFP from a RSV promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoterRous Sarcoma Virus(RSV)Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-dgRNA-CAG-MPH
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-ChR2-YFP
Plasmid#171622PurposeTRE-ChR2-YFP reporterDepositorInsertTRE-ChR2-YFP
UseAAV and Synthetic BiologyExpressionMammalianPromoterTetOAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRger2-TS-EYFP
Plasmid#127237PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by human Synapsin I promoter.DepositorInsertChRger2-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterhSyn1Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ASAP4b-Kv-WPRE
Plasmid#201030PurposeExpresses somatically enriched ASAP4b in neurons, can be used to package AAVDepositorInsertASAP4b-Kv
UseAAVAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_CAG_V5-LOV-Turbo-NES
Plasmid#199670Purposeexpresses V5-LOV-Turbo-NES in mammalian cells, AAV vectorDepositorInsertLOV-Turbo
UseAAVTagsNES and V5PromoterCAGAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn1-synaptophysin-mCherry-V5
Plasmid#250167PurposeNeuronal overexpression of synaptophysin fused to mCherryDepositorAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-pAce-Kv2.1PR
Plasmid#195529PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-TC66T-2A-EGFP-2A-oG
Plasmid#178429PurposeExpresses TVA(TC66T), EGFP, and optimized Rabies G (oG) protein in a FLEX cassetteDepositorInsertsTVA950 Glu66→Thr
Optimized G
EGFP
UseAAV and Cre/Lox; Adeno-associated virusPromoterhSynAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iATPSnFR2.S29W.A95K.HaloTag
Plasmid#209659PurposeExpression of iATPSnFR2, high affinityDepositorInsertiATPSnFR2.S29W.HaloTag
UseAAVMutationS29W.A95KPromoterGFAPAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-Mac
Plasmid#200658PurposeSynthetic construct isolate AAV.CAP-Mac VP1 geneDepositorInsertSynthetic construct isolate AAV.CAP-Mac VP1 gene
UseAAVExpressionMammalianMutation7 amino acid insertion after Q588 of the AAV9 CAP…Promoterp41Available SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-36: AAVS1-mEGFP (PGK)
Plasmid#114404PurposeHomology arms and linker-mEGFP sequence for internal insertion of PGK-mEGFP at the AAVS1 safe harbor location in human cells as a reporter for cytoplasmic mEGFPDepositorInsertAAVS1 Homology Arms with PGK driven mEGFP (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 4, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOTTC1328 - pAAV EF1a HA-hM3D(Gq)
Plasmid#89149PurposeAn AAV packaging plasmid that expresses HA-tagged hM3D(Gq) excitatory DREADD from the EF1a promoter.DepositorInserthM3D(Gq)
UseAAVTagsHAExpressionMammalianPromoterEF1aAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-GECO2G
Plasmid#159605PurposeAAV production plasmid encoding for near-infrared calcium indicator NIR-GECO2GDepositorHas ServiceAAV1, AAV2, and AAV9InsertNIR-GECO2G
UseAAVExpressionMammalianPromoterCAGAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypEGFP
Plasmid#153203PurposeCan be used to generate AAV virus that will mark the presynaptic terminal (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertsynaptophysin-EGFP
UseAAVPromoterrat synapsinAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-HcKCR1-EYFP
Plasmid#182021PurposeExpress light-gated potassium channel HcKCR1-EYFP in mammalian cellsDepositorInsertHcKCR1
UseAAVTagsEYFPExpressionMammalianAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-sCAG-eGFP-ACAP1
Plasmid#203800PurposeAAV vector plasmid expressing human ACAP1 fused to eGFP under a short variant of the CAG (sCAG) promoterDepositorAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1
Plasmid#115341PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1DepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-HaloDA1.0
Plasmid#234408PurposeExpresses the chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0 in neuronsDepositorInsertGPCR activation based chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0
UseAAVPromoterhSynAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-4mtGCaMP6f-DIO
Plasmid#179529PurposeCre-dependent expression of mitochondria-targeted GCaMP6f under control of the EF1a promoterDepositorHas ServiceAAV1Insert4mtGCaMP6f
UseAAVTags4x Cox8 targeting sequencePromoterEf1aAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1b-ST-WPRE
Plasmid#214967PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for brighter fluorescenceDepositorInsertCepheid1b-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgRNA
Plasmid#124845PurposeVector for FLP-dependent expression of SaCas9 with gRNADepositorInsertSauCas9 gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 hPGK-PuroR-pA donor
Plasmid#22072DepositorInsertPGK-Puro (PGK1 Human)
UseZfn donorAvailable SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only