We narrowed to 10,395 results for: EPO
-
Plasmid#96994PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-FLL[157-159]AAA
Plasmid#96991PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIS1 HK1
Plasmid#60794PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains HK1 3' UTR and wild-type miR-155 sitesDepositorInsertHK1 3'UTR and wild-type miR-155 binding site (HK1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mHK1
Plasmid#60795PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains HK1 3' UTR and mutated miR-155 sitesDepositorInsertHK1 3'UTR and mutated miR-155 binding site (HK1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-stop-mut
Plasmid#53713PurposeLuciferase reporter assay for CIP2A with mutated firefly stop codonDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on the stop codon of firefly luciferase …Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#10 in pTwist-CMV backbone
Plasmid#216154PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Leaky but very sensitive to mild TDP-43 loss of function. It uses a cryptic exon. [Code 'B5'] Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic exon and C-terminal FLAG
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.PDGFR
Plasmid#178333PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorInsertpAAV CAG iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.22-PGK1-HRE::dLUC
Plasmid#128095PurposeHypoxia response element real-time luciferase reporterDepositorInsertHypoxia response element (x3) from PGK1 promoter (PGK1 Human)
UseLuciferaseTagsdrives expression of destabilized luciferase (2CP…ExpressionMammalianPromoterinserted PGK1 hypoxia response elements (HRE) (x3)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.GPI
Plasmid#178335PurposeFluorescent reporter for glutamate, third generation, variant 857 in GPI backbone. iGluSnFR3.v857.GPIDepositorInsertpAAV CAG iGluSnFR3 v857.GPI
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsGPI Anchor, IgK-chain, and Myc epi tagExpressionMammalianAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Egr1-CytoTape-V5
Plasmid#239428PurposeCytoTape signal monomer for recording Egr1 promoter transcriptional activityDepositorInsertCytoTape-V5 (EGR1 Synthetic)
UseAAVTagsV5-dMBPExpressionMammalianPromoterEgr1 promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-W
Plasmid#67986PurposeCas9 activity reporter with mCherry and BFPDepositorInsertsU6gRNA cassette, PGKmCherryABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-mVenus-p27K−
Plasmid#176651PurposeIt encodes an mVenus fused to a mutant p27K-, which lacks binding affinity to Cdk. This reporter helps to identify quiescent disseminated tumor cells (in G0 phase of cell cycle).DepositorInsertmVenus-p27K- (Cdkn1b Mouse)
UseLentiviralTagsmVenusMutationMutant K- (lacks affinity to Cdk)Available SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Fucci(CA) hCdt1-iRFP hGeminin-TagBFP2
Plasmid#190181PurposeFluorescent reporter vector to visualize all of cell cycle phases.DepositorInsertsExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 FLAG-YAP1-TEAD-P-H2B-mCherry
Plasmid#128327PurposeReporter to evaluate YAP1/TEAD-mediated gene transcriptionDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12D-IRES-mCherry
Plasmid#221022PurposeFluorescent reporter for expressing the KRAS G12D mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-iSeroSnFR
Plasmid#128484PurposeFluorescent reporter for serotonin (mammalian expression, membrane localization tag)DepositorInsertiSeroSnFR
TagsIg-kappa leader, Myc, PDGFR + enhanced ER export,…ExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only