We narrowed to 13,850 results for: sequence
-
Plasmid#72085PurposeExpresses the extracellular region of the LRRC4C protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only
-
UbG76V-eGFP-V5His_15aa
Plasmid#23969DepositorInsertUb-G76V-eGFP-V5HIS_15aa (UBB Human)
TagseGFPExpressionMammalianMutationG76V mutation in Ubiquitin. Ub fused to N-termin…Available SinceApril 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-Avi-Cerulean-Rpl10a
Plasmid#79882PurposeUbiquitin promoter driving Avi-tagged protein containing Cerulean protein fused to zebrafish Rpl10a ribosomal unit (Tryon et al. 2012); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to zebrafish Rpl10a ribosomal unit (rpl10a Zebrafish)
TagsAviExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-cytoBirA-2A-mCherry_Ras
Plasmid#80066PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-1
Plasmid#133353Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-BLMP-1-pcDNA3.1-
Plasmid#52512Purposeexpresses C. elegans BLMP-1 in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertBlmp-1 (blmp-1 Nematode)
TagsFLAG-HAExpressionMammalianMutationN75S mutation compared GenBank reference sequence…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
KCC2-pHext
Plasmid#104076PurposeTo visualize the expression and localization of potassium-chloride cotransporter type 2 (KCC2)DepositorInsertKCC2 (b isoform) (Slc12a5 Rat)
TagspHluorine tag inserted in the second putative tra…ExpressionMammalianMutationEcoR1 site in rat KCC2 was removed by silent muta…PromoterUbCAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINTphiC31
Plasmid#127535PurposePlasmid encodes A. thaliana codon optimized Integrase phiC31.DepositorInsertIntegrase phiC31 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG NBT:NRGIIIa:polyA
Plasmid#193012PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa in neuronsDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
ZIKV_Trigger_32B
Plasmid#75009PurposePortion of Zika Virus genome (KU312312: 7166-7299) containing sensor 32B trigger sequenceDepositorInsertZIKV_Trigger_32B
ExpressionBacterialPromoterT7Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCF2_STOP
Plasmid#221425PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertABCF2 (ABCF2 Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flrt1-Fc-His
Plasmid#72073PurposeExpresses the extracellular region of the FLRT1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINT13
Plasmid#127534PurposePlasmid encodes A. thaliana codon optimized Integrase 13.DepositorInsertIntegrase 13 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
MEF2A-Sensor
Plasmid#208928Purposein vitro MAPK-Sensor for luminescent detection of ERK and p38-activityDepositorInsertMef2a docking sequence+Phospho site (MEF2A Human)
TagsHISx6, MBP, and SmbitExpressionBacterialPromoterT7Available SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
Sema4d-Fc-His
Plasmid#72157PurposeExpresses the extracellular region of the Sema4D protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
(p)odr-3::GFP::EGL-4
Plasmid#100897PurposeGFP and the EGL-4 cDNA driven by the odr-3 promoter, which expresses in the AWA, AWB, and AWC olfactory sensory neurons in C. elegans. unc-54 3'UTR in sequence as well.DepositorInsert56-2741: odr-3 promoter
ExpressionWormPromoterodr-3Available SinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-GRM3-VC
Plasmid#98968Purposemyc-tagged human mGluR3 fused to C-terminus of split VenusDepositorInsertGRM3 (GRM3 Human)
TagsSignal/leader sequence from HLA class I A-2 alpha…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRS-Leader-SARS-CoV-2-EGFP
Plasmid#171585PurposeExpression of 75 nt of the SARS-CoV-2 Leader sequence at 5' of destabilized eGFP reporterDepositorInsertTRS-Leader-SARS-CoV-2-d2eGFP
UseLentiviralTags2PEST AND NLSAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNAscaffold 2.1 scRNA (GB1437)
Plasmid#160571PurposeVersion of SgRNA scaffold with the sequence 2.1 of Ms2 aptamer in the 3' end.DepositorInsertsgRNAscaffold 2.1 scRNA
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only