We narrowed to 16,664 results for: grn
-
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2519
Plasmid#91076PurposeModule B, Promoter: OsU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterOsU3Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGRACE
Plasmid#230910PurposeTracing of CRISPR activity in whole animals.DepositorInsertGFP
UseCRISPRExpressionInsectAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCutamp
Plasmid#140632PurposePlasmid-curing in Escherichia coli by targeting the AmpR promoterDepositorInsertSpCas9_lambda-RED system, SacB, Rha induction system, sgRNA targeting AmpR promoter
UseCRISPRExpressionBacterialAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Agam_695
Plasmid#176654PurposeExpression of sgRNA under An. gambiae U6-2 (AGAP013695) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos1.0
Plasmid#73639PurposeGenome editing for gene pyrE (CAC-002) in Clostridium acetobutylicum ATCC 824DepositorInsertsCas9 nickase
sGRNA to pyrE
UseE.coli-clostridium shuttle vectorMutationD10APromoterj23119 and ptbAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
UAST-uMCas12a+nls2x
Plasmid#230909Purposeinducible expression of Cas12a+ with Gal4.DepositorInsertCas12a+
UseCRISPRAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2518
Plasmid#91075PurposeModule B, Promoter: TaU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterTaU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi
Plasmid#199808Purposevector for constitutive CRISPRi-mediated gene knockdown in S. aureusDepositorInsertsdCas9
sgRNA with GFP cassette
UseCRISPRPromoterP23 and PRAB17 (sgRNA) and SarAP1 (GFP)Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT449
Plasmid#139389PurposeBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2)
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
iMAP-61
Plasmid#187460PurposegRNA array of iMAP-61DepositorInsertsgRNA array
UsePiggybacExpressionMammalianPromotermodified U6Available SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS613_pTetR-P2A-BFPnls/sgTelo
Plasmid#108649PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInsertsTelomere-targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-3XpolyA-3XPC-miniCMV-mCherry-WPRE-insulator
Plasmid#168291Purposeoptimized miniCMV (OminiCMV)DepositorInsertmCherry
ExpressionMammalianPromoterminiCMVAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Donor
Plasmid#159740PurposeContains EGFP flanked by a splice acceptor and a splice donor. Together with other intron tagging plasmids, it can be used to place the EGFP tag as a synthetic exon into introns of target genes.DepositorInsertEGFP
UseIntron tagging donorAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42337PurposeDual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only