169,450 results
-
Viral Prep#105551-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (#105551). In addition to the viral particles, you will also receive purified pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 plasmid DNA. Expression of GFP-Cre from CamKII promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsGFPAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pDragon-Ctgf
Plasmid#155015PurposeFor Flp-mediated cassette exchange. Expresses tdTomato in the presence of (r)tTA, switching to connective tissue growth factor in the presence of Cre and (r)tTA activity.DepositorAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_3xFLAG_V5_ mmIfih1_V5
Plasmid#160110PurposeExpresses murine Ifih1 in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSyn1-mRuby2-T2A-GCaMP6f
Plasmid#197595PurposeLentiviral transfer vector for the neuronal expression of mRuby2-T2A-GCaMP6f (fluorescent reporter for Calcium imaging)DepositorInsertmRuby2-T2A-GCaMP6f
UseLentiviralPromoterhSynIAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean
Plasmid#154951PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorHas ServiceAAV Retrograde, AAV5, and AAV9InsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterhuman synapsinAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xFLAG-TEV-UBE2O
Plasmid#105718PurposeExpresses WT full length human N- terminally tagged UBE2ODepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZyxin-mMaple3
Plasmid#101151PurposeFluorescent protein for superresolution imaging and a focal adhesion protein for binding substrateDepositorInserthuman codon optimized mMaple3 fused to zyxin
ExpressionMammalianPromotercmvAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF2546
Plasmid#144209PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-con/fon DREADD Gq-mCherry
Plasmid#200661PurposeConstruct for chemogenetically activating and visualizing subpopulations of neurons in the retinaDepositorInsertDREADD Gq-mCherry
UseAAV, Cre/Lox, and Mouse Targeting ; IntrsectTagsmCherryExpressionMammalianPromoterhSynAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (AAV1)
Viral Prep#84446-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (#84446). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] plasmid DNA. CAG-driven, Cre-dependent expression of Jaws-KGC-tdTomato-ER2 for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT-HA-hM3D(Gq)
Plasmid#45547PurposeExpresses hM3D (Gq) neuronal activatorDepositorInserthM3D (Gq)
TagsHAExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-{CMV-CuO}>{PAX3::FOXO1}:T2A:mCherry
Plasmid#236629PurposePuromycin selected lentiviral construct with cumate-inducible PAX3::FOXO1DepositorUseLentiviralExpressionMammalianPromoterCMV-CuOAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR_Pax6-RE_tBFP_PGK_mCitrine
Plasmid#188388PurposeLentiviral vector - tBFP reporter for Pax6-based SNIPRs with a constitutive mCitrineDepositorInsertPax6-RE_tBFP_PGK_mCitrine
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBh_NLS_dCas13X_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#191796Purposevector for encoding a human codon-optimized dead Cas13X (dCas13X) driven by CBh promoter, guide RNAs compatible with Cas13X driven by hU6, EGFP driven by SV40 promoter, and mCherry driven by SV40 promoterDepositorInserthumanized dCas13X
UseCRISPRExpressionMammalianMutationR84A, H89A, R739A, R740A, H745A, H746A, H747APromoterCBh, SV40, hU6Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-sfGFP WT
Plasmid#197569PurposeExpression of sfGFP WT with Methanosarcina barkeri (Mb) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
Pyl-tRNA (4 copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
paavCAG-pre-mGRASP-mCerulean
Plasmid#34910PurposepreDepositorHas ServiceAAV5Insertpresynaptic mGRASP
UseAAVPromoterCAGAvailable SinceNov. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-oA ONE-GO
Plasmid#189732PurposeGPCR/G protein BRET biosensorDepositorAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Ef1a-Con/Foff 2.0-BFP (AAV8)
Viral Prep#137130-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Foff 2.0-BFP (#137130). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Foff 2.0-BFP plasmid DNA. EF1a-driven, Cre-dependent expression of BFP (inhibited in the presence of Flp recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsBFP (Cre-dependent)Available SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only