We narrowed to 25,345 results for: Spr
-
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.V5_mCherry-NLS
Plasmid#178242PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
JG1202: CAG-human dLbCpf1(D832A)-NLS-3xHA-P65
Plasmid#104566PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to p65 activation domainDepositorInsertdLbCpf1(D832A)-p65
Tags3x HA and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.VSVg_mCherry-NLS
Plasmid#178220PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.S_mCherry-NLS
Plasmid#178219PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.HSV_mCherry-NLS
Plasmid#178216PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.VSVg_mCherry-NLS
Plasmid#178214PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.S_mCherry-NLS
Plasmid#178213PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.HSV_mCherry-NLS
Plasmid#178210PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY152
Plasmid#130950Purposedcas9 generator and reporter circuit (PpspA-2G6 with sfgfp::ASV)DepositorInsertsdcas9
tetR
sfgfp
UseSynthetic BiologyTagsASV tagExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPpspA-2G6 and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only