We narrowed to 14,387 results for: Cas9
-
Plasmid#190638PurposePuromycin-selectable expression of HA-tagged Dora[T295M] (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationChanged threonine 295 to methioninePromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[A]_rescue_construct
Plasmid#190640PurposePuromycin-selectable expression of HA-tagged truncated Dora (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationTruncated to contain amino acids 1-945PromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA3
Plasmid#172711PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTOPO-col10a1-KI-donor
Plasmid#184874PurposeDonor template for knock-in of p2a-CreERT2 into the medaka col10a1 locus via CRISPR/Cas9-mediated homology directed repairDepositorInsertsCollagen10a1 5' homology arm
Collagen10a1 3' homology arm
p2a-CreERT2
Myosin light chain 2 promoter
eGFP
UseCRISPR and Cre/LoxAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-CfANLN
Plasmid#183837PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in canine cells using CRISPR/Cas9.DepositorInsertCanis familiaris ANLN homology arms with mNeonGreen-linker
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEgf
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#2
Plasmid#163389PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#1
Plasmid#163388PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#3
Plasmid#163390PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-SQSfl
Plasmid#171010PurposeHiLITR protease with full-length SQS targeting information (ER)DepositorInsertEGFP-uTEV1-SQS(FL)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRWJB006
Plasmid#160113PurposeDestination vector expressing plant-codon-optimized Cas9 under 35S promoter (BamHI and NotI), with sgRNAs be shuffled in; seed coat specific red fluorescence for screening trangene freeDepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoter35SAvailable SinceFeb. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRWJB004
Plasmid#160112PurposeDestination vector expressing plant-codon-optimized Cas9 under UBQ10 promoter (BamHI and NotI), with gRNAs be shuffled in; seed coat specific red fluorescence for screening trangene free plants;DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoterUBQ10Available SinceFeb. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT174_GalL_A3A-Y130F-BE3
Plasmid#145123PurposeExpressing base editor A3A-Y130F-BE3 in yeast cellsDepositorInsertA3A(Y130F)-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT173_GalL_A3A-R128A-BE3
Plasmid#145122PurposeExpressing base editor A3A-R128A-BE3 in yeast cellsDepositorInsertA3A(R128A)-BE3
UseCRISPRExpressionYeastMutationA3A(R128A); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only