We narrowed to 23,514 results for: ESC
-
Plasmid#137039Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0323 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66700.1
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Gamma-Tubulin-17
Plasmid#55485PurposeLocalization: Centrosomes, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-ELP-1-25
Plasmid#55478PurposeLocalization: Golgi/ER, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYTSK65K_8G7
Plasmid#177303Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and GUSDepositorInsertuidA
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW14K_7G5
Plasmid#177283Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBB0238-TEV-His12
Plasmid#137038Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0238 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66635.2
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-FYN-N-10
Plasmid#55483PurposeLocalization: Membrane Associated Kinase, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-SiT-N-15
Plasmid#55508PurposeLocalization: Golgi TGN, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GreenGate 2.0 Toolkit
Plasmid Kit#1000000241PurposeCompatible with GreenGate Cloning System (#1000000036). Includes modules for CRISPR/Cas9 genome editing, dexamethasone-inducible expression, and fluorescent plasma membrane and nuclear markers.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector TypePlant ExpressionEditing TypeCRISPRCloning TypeGolden Gate (GreenGate)Available SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
MXS Chaining Kit
Plasmid Kit#1000000064PurposeA collection of standardized building blocks used to assemble plasmids that are optimized for fluorescence imaging or flow cytometry applications.DepositorApplicationCloning and Synthetic BiologyVector TypeMammalian ExpressionCloning TypeRestriction EnzymeAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mNeonGreen
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB120
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
ExpressionPlantPromoterpNOSAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMH0006
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianPromoterEF1AAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHtrA-TEV-His12
Plasmid#137036Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi HtrA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66500.2 (BB_0104 Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc
Plasmid#113862PurposeTriple pathway reporter, 3P-Luc; wnt-NLuc1.1, hedgehog-FLuc, notch-GLuc; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-NLuc1.1
12GLI-Fluc
CBF-GLuc
UseLentiviralExpressionMammalianAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
eMscL WT
Plasmid#107454PurposeeMscL WT is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia Coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianPromoterhuman synapsin 1Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pELPS-eDHFR-YFP-T2A-Renilla
Plasmid#193253PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferaseDepositorInsertThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
UseLentiviralTagsRenilla luciferase (rLuc) and yellow fluorescent …MutationNonePromoterEF1aAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
GANES-DEVD-BNLS
Plasmid#50842PurposeExpresses a tandem green ddFP heterodimer in mammalian cells, construct 1 for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid RANLS.DepositorInsertddGFP A and ddGFP B
TagsNES sequence LALKLAGLDIGS placed after ddGFP A an…ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
RANLS-DEVD-BNES
Plasmid#50840PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-3 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
TagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only