We narrowed to 8,829 results for: sgRNA
-
Plasmid#127119DepositorInsertgRNA TRIM25 (TRIM25 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMD9
Plasmid#110626PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSGKP_AcsgRNA
Plasmid#203807PurposepSGKP-based plasmid containing a J23119-driven sgRNA cassette, with replaceable spacer (BsaI-restriction sites). Kanamycin resistance.DepositorInsertAcgRNA
UseCRISPRPromoterJ23119Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ZNF598
Plasmid#127121DepositorInsertgRNA ZNF598 (ZNF598 Human)
UseCRISPRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_ASCL1
Plasmid#64129PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBLsgRNA1
Plasmid#199727PurposeGolden Gate entry vector; 1st gRNA under OsU3 promoterDepositorInsertOsU3-sgRNA1 scaffold
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBLsgRNA2
Plasmid#199728PurposeGolden Gate entry vector; 2nd gRNA under OsU3 promoterDepositorInsertOsU3-sgRNA2 scaffold
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_ASCL1
Plasmid#64130PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.RFP657
Plasmid#169939PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and RFP657 from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1S_AmpR
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T2_AmpR
Plasmid#119159PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T3_AmpR
Plasmid#119160PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T1_AmpR
Plasmid#119158PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
EC2_7_dCas9_HC_sgRNA
Plasmid#163711PurposeHigh copy plasmid with dCas9 and sgRNA expression cassettesDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only