We narrowed to 44,318 results for: tra
-
Plasmid#50830Purposeluciferase reporter for human miR-34aDepositorInsertmiR-34A promoter M53 (MIR34A Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationp53 binding site mutated (-39)PromotermiR34aAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCA-G-intron-T
Plasmid#36885DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, insertiā¦PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-H-Ras_V12
Plasmid#39516DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCS2 Smad1 EVE GM
Plasmid#27997DepositorInsertHuman Smad1 EVE Gsk3 mutant (SMAD1 Human)
TagsFlagExpressionMammalianMutationS463E S465E S210A T202A S191A S198AAvailable SinceSept. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
ATF4 18: RLuc.5āATF4.GFP
Plasmid#21864DepositorAvailable SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
608 pSG5L HA RB del ex4
Plasmid#10730DepositorAvailable SinceOct. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-RiboL1-jGCaMP8f
Plasmid#169249PurposeAAV transfer plasmid for neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8f, with a flexible GS-linker sequence attaching the ribosomal tag to the jGCaMP8f protein.DepositorInsertRiboL1-jGCaMP8f
UseAAVTags6xHisExpressionMammalianPromoterhSynAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gad67-WPRE-HGHpA
Plasmid#184632PurposeExpresses Gad67, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term FBL
Plasmid#187577PurposeExpress FLAG epitope and APEX2-tagged FBL fusion protein in mammalian cellsDepositorAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDmAct5C::Cas9-2A-Neo
Plasmid#176679PurposeExpression of Drosophila codon optimized spCas9 under Drosophila Act5C promoterDepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterD. melanogaster Act5CAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRGEN-CMV-VPR-L1-CjCas9 V-D
Plasmid#169913PurposeExpression of a VPR-dCjCas9 fusion protein to activate gene expression.DepositorInsertdCjCas9
UseCRISPRTags2xSV40NLS, SV40NLS-HA, and VPR (VP64-p65-Rta)ExpressionMammalianMutationD8A, H559A in cjCas9PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQLink-GST-10xCTD
Plasmid#138472PurposeExpresses GST-tagged 10xCTD heptapeptide repeat in bacteriaDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-sTomato-NLS. PGK-puro
Plasmid#136261PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagssTomato-NLSExpressionMammalianAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
C1-FT-mCitrine-EEVEE-CaaX
Plasmid#155225PurposeMPAct with increased linker flexiblityDepositorInsertF-tractin (aa 9-52 of rat ITPKA) fused to mCitrine C-term tagged with a codon optimized EEVEE and CaaX seq derived from Kras4b
TagsmCitrineExpressionMammalianAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN441
Plasmid#137873PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE Tight ArchT-GFP
Plasmid#79627PurposeTetracycline-dependent expression of ArchT-EGFP in mammalian cellsDepositorInsertArchT
TagsEGFPExpressionMammalianMutationArchT is a more sensitive version of Arch (archaeā¦PromoterTet responsive Ptight promoterAvailable SinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxna3-Fc-His
Plasmid#72124PurposeExpresses the extracellular region of the PlexinA3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4d-Fc-His
Plasmid#72157PurposeExpresses the extracellular region of the Sema4D protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-SAR1
Plasmid#67472PurposeMammalian expression of hSar1 with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only