We narrowed to 2,989 results for: cmv promoter
-
Plasmid#190740PurposeMammalian expression of DCX fusion to V5-tagged TurboID on microtubules (DCX as the microtubule-targeting tag)DepositorInsertdoublecortin (DCX Human)
UseTagsTurboID and V5ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rock1-GBD (840-110 aa) in pEGFPN1
Plasmid#187279PurposeExpress EGFP-Rock1 GTPase-binding domainDepositorInsertRock1 (Rock1 Mouse)
UseTagsEGFPExpressionMammalianMutationGBD (84-110aa)PromoterCMVAvailable sinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Ub-VPS13D
Plasmid#176462Purposeexpressing GFP-Ub marked VPS13D in mammalian cells. GFP-Ub will be cleaved by DUBs to express untagged VPS13DDepositorInsertVPS13D (VPS13D Human)
UseTagsGFP-UbExpressionMammalianMutationPromoterCMVAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Ub-VPS13D N3521S
Plasmid#176463Purposeexpressing VPS13D patient mutant N3521S in mammalian cellsDepositorInsertVPS13D (VPS13D Human)
UseTagsGFP-UbExpressionMammalianMutationN3521S mutationPromoterCMVAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-Tapasin-TAPBPR 22-35
Plasmid#153478PurposeMammalian expression of FLAG-tagged Tapasin with TAPBPR a.a. 22-35DepositorInsertTAPBP (TAPBP Human)
UseTagsFLAGExpressionMammalianMutationTapasin a.a.10-20 replaced with TAPBPR a.a. 22-35PromoterCMVAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-N-Myc-Flag-BirA-hPOT1-DeltaOB
Plasmid#166410Purposeexpress BirA-hPOT1 ΔOB in mammalian cellsDepositorInsertPOT1 ΔOB (POT1 Human)
UseTagsMYC-flag-BirAExpressionMammalianMutationΔOBPromotercmvAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
NanoBRET BiBRET Vector, NanoLuc-KRAS WT-CRAF RBD-CRD-HaloTag
Plasmid#236865PurposeExpress NanoLuc(R)-KRAS WT-CRAF RBD-CRD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector HaloTag-KRAS 2B WT-BRAF RBD-NanoLuc
Plasmid#236853PurposeExpress HaloTag(R)-KRAS 2B WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLC-Flag-CRBN-P2A-Hygro
Plasmid#124303PurposeLentiviral vector for expression of Flag tagged CRBN-P2A-Hygro casette from a CMV promoterDepositorInsertCRBN (CRBN Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 F-tractin-EGFP
Plasmid#58473PurposeExpresses a cytoplasmic actin filament reporter, the neuronal inositol 1,4,5-triphosphate 3-kinase A actin-binding domain known as F-tractin, on a CMV promoterDepositorInsertF-tractin (Itpka Rat)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
L1-neo-TET
Plasmid#51284Purposeexpresses codon optimized human L1 retrotransposon driven by CMV promoter and tagged with the self splicing intron neo cassetteDepositorInsertL1RE1 (L1RE1 Human)
UseTagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
TAK11
Plasmid#227095PurposeLuciferase reporter vector with HIV-1 TAR region cloned in pGL3 Basic vectorDepositorInsertCMV Promoter and HIV-1 TAR region
UseLuciferaseTagsExpressionMutationPromoterCMVAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianMutationPromoterCMVAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_D2A_tdTomato
Plasmid#184045PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using a dual 2A peptide sequence (P2AT2A)DepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Dual 2A Peptide Sequence
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_IRES_tdTomato
Plasmid#184046PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using an IRES sequenceDepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Internal Ribosome Entry Site
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-CUL4A WT-P2A-Puro
Plasmid#124304PurposeLentiviral vector for expression of wild-type CUL4A-P2A-Puro casette from a CMV promoterDepositorInsertCUL4A (CUL4A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
TAK8
Plasmid#227096PurposeLuciferase reporter vector with wild type 5' Element (MMTV) insertDepositorInsertCMV Promoter and R to 400bp Gag
UseLuciferaseTagsExpressionMutationPromoterCMVAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1318
Plasmid#217960PurposeExpression of human H4 carrying three point mutations to disrupt binding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
UseTagseGFPExpressionMammalianMutationL63A, F66A, I71APromoterCMVAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1317
Plasmid#217959PurposeExpression of human H4 carrying a triple glycine insertion to disrupt folding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
UseTagseGFPExpressionMammalianMutationGGG insertion between V65 and F66PromoterCMVAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1314
Plasmid#217956PurposeExpression of human H3.1 carrying a triple glycine insertion to disrupt folding with H4. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H3.1 (H3C1 Human)
UseTagseGFPExpressionMammalianMutationGGG insertion between A95 and C96PromoterCMVAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PGUS
Plasmid#207827PurposeFLAG-tagged PGUS driven by CMV promoterDepositorInsertPGUS
UseLentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-SENP8 sg2R-P2A-Hygro
Plasmid#124300PurposeLentiviral vector for expression of Flag tagged SENP8-P2A-Hygro casette from a CMV promoter. SENP8 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertSENP8 (SENP8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pThom77.6
Plasmid#101637PurposeEncodes the fluorescent protein amFP486/K68M under a CMV promoter.DepositorInsertamFP486/K68M
UseTagsExpressionMammalianMutationK68MPromoterCMVAvailable sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST26-PPP2CB-C-HA
Plasmid#195179PurposeVector for transient expression of PPP2CB gene with C-terminal HA tag, gene flanked by att sites for gateway cloningDepositorInsertPPP2CB (PPP2CB Human)
UseTagsHAExpressionMammalianMutationPromoterCMV promoterAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro
Plasmid#208646PurposepcDNA3.1 based empty vector for transient transfection of sgRNA-cas9. U6 promoter ~ puro Res cloned from lentiCRISPRv2 (Addgene#52961), lenti virus sequences not included.DepositorTypeEmpty backboneUseCRISPRTagsClawed frog nucleoplasmin NLS, Flag, Puromycin re…ExpressionMammalianMutationPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST26-MSRA-C-HA
Plasmid#195177PurposeVector for transient expression of MSRA gene with C-terminal HA tag, gene flanked by att sites for gateway cloningDepositorInsertMSRA (MSRA Human)
UseTagsHAExpressionMammalianMutationPromoterCMV promoterAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
UVR8-mCherry
Plasmid#49804Purposeexpresses mCherry fused to UVR8 under the CMV promoterDepositorInsertUVR8-mCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only