We narrowed to 2,071 results for: quo
-
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD128
Plasmid#163097PurposeExpression of mTurquoise2_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmTurquoise2_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-nsGFP
Plasmid#132975Purposegata2a endothelial enhancer (x6) and basal promoter driving nuclear-localized sfGFP in pTol1 backboneDepositorInsertsnuclear localized sfGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedTags6x myc and SV40 NLSAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSS02:cyt-Peredox-mCherry
Plasmid#161743Purposecytosolic expression of fluorescent NADH/NAD+ biosensor Peredox-mCherry in plantsDepositorInsertcyt-Peredox-mCherry
ExpressionPlantPromoterUbiquitin 10Available SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-EGFP-CAAX
Plasmid#208683PurposeExpresses the membrane-localized enhanced green fluorescent protein EGFP-CAAX in mammalian cellsDepositorInsertmembrane-localized enhanced green fluorescent protein EGFP-CAAX
ExpressionMammalianPromoterCMVAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
EphA2-MT
Plasmid#108851PurposeEncodes for human EphA2 fluorescently labeled with mTurquoise on the C-Terminus via a 15 amino acid (GGS)5 flexible linkerDepositorInsertEPHA2 (EPHA2 Human)
TagsLabeled with mTurquoise on the C-Terminus via a 1…ExpressionMammalianAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
aP2-GFPtpz
Plasmid#114211PurposeaP2/Fabp4 promoter driving GFPtopaz for labeling differentiated adipocytes and macrophageDepositorInsertaP2 promoter + pOB4 + eGFPtopaz (Fabp4 Aequorea victoria, Synthetic, Mouse)
TagsNoneExpressionMammalianPromoteraP2/Fabp4Available SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-MPro-eGFP-2
Plasmid#184824PurposeExpresses Mpro-eGFP in mammalian cellsDepositorInsertMpro-eGFP conjugate (M SARS-CoV-2, jellyfish Aequorea Victoria)
UseLentiviralExpressionMammalianPromoterEF-1alfaAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H74
Plasmid#170338PurposemTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarR
Plasmid#31222DepositorInsertCD4-tdTom (CD4 Aequorea victoria, Fly, Human)
TagsCD4 and tdTomatoExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV AURKA-mTurq2
Plasmid#157767PurposeExpression of AuroraA kinase fused to mTurquoise2 under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2706-pHAGE-EF1aL-YAP5SA-UBC-GFP
Plasmid#216475Purposelentiviral dual expression of YAP5SA and eGFPDepositorInsertsYAP5SA
eGFP
UseLentiviralMutationS61A, S109A, S127A, S164A, S381APromoterEF1aL and UBCAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
FHL-cpmTq2-Calcium-lifetime-sensor
Plasmid#129628PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsertFHL-cpmTq2-Calcium-lifetime-sensor
Tags6x His - Modified TorA MNNNDLFQASRRRFLAQLG[G to …ExpressionBacterial and MammalianPromoterCMV,&RhamnoseAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS
Plasmid#162616PurposeAllows for transcription of control mCerulean fluorophore half for injection into zebrafish embryos for BiFC assaysDepositorInsertmCerulean
ExpressionMammalianMutation156-239Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarG
Plasmid#31221DepositorInsertCD4-tdGFP (CD4 Aequorea victoria, Fly, Human)
TagsCD4 and EGFP/GFPExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1_VNp-LZ-VenusN154_VNp-LZ-VenusC155 (BiFC construct)
Plasmid#182395PurposeBacterial expression of Vesicle Nucleating peptide-Leucine Zipper-amino-half_mVenus BIFC fragment n and Vesicle Nucleating peptide-Leucine Zipper-carboxyl-half_mVenus BIFC fragment fusionsDepositorInsertsVNp-LZ-VenusN154
VNp-LZ-VenusC155
TagsVesicle Nucleating peptide (VNp) & Leucine Zi…ExpressionBacterialPromoterT7Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only