We narrowed to 3,240 results for: Streptococcus
-
Plasmid#73196PurposeHuman expression plasmid for SpCas9(R661A/Q695A/Q926A) variant: CMV-T7-humanSpCas9(R661A, Q695A, Q926A)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (R661A/Q695A/Q926A)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationR661A, Q695A, and Q926A in SpCas9PromoterCMVAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-CBE4max-SpRYc-P2A-EGFP
Plasmid#208336PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpRYcDepositorInserthuman codon optimized CBE4max Cas9 variant named SpRYc with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationSc++ (1-1119), SpRY (1111-1368), D10APromoterCAGAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAEL007584-Cas9
Plasmid#100706PurposeThe promoter of AAEL007584 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL007584-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL007584 and Opie2Available sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6a-V106W
Plasmid#215824PurposeExpress CBE6a-V106W (with SpCas9) in mammalian cellsDepositorInsertCBE6a V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133345Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA2
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_cpaA- Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133347Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets cpaA and second one targets blaA (from Caulobacter crescentus)DepositorInsertsgRNA_cpaA and sgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgCTG
Plasmid#232723PurposeSpCas9 guide RNA targeting CAG repeats for C-to-T base editingDepositorInsertSpCas9 gRNA targeting CAG repeats
ExpressionMammalianAvailable sinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRS-AraC-dCas9
Plasmid#220195Purposemini-Tn7 dCas9 expression vector - AraC/pBAD promoterDepositorInsertPseudomonas aeruginosa-codon optimized Streptococcus pyogenes dCas9
UseCRISPRExpressionBacterialMutationPseudomonas aeruginosa codon optimizedPromoterAraC/pBADAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRS-LacI-dCas9
Plasmid#220194Purposemini-Tn7 dCas9 expression vector - LacI/pLac promoterDepositorInsertPseudomonas aeruginosa-codon optimized Streptococcus pyogenes dCas9
UseCRISPRExpressionBacterialMutationPseudomonas aeruginosa codon optimizedPromoterLacI/pLacAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216249PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgRANGAP.C1 to tag endogenous RANGAP1 C-terminusDepositorPublicationInsertCas9 and sgRANGAP.C1 (RANGAP1 Human)
UseCRISPR; Endogenous taggingExpressionMammalianPromoterCAGAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9GG
Plasmid#131009PurposeBackbone plasmid for generating CRISPR arrays for SpCas9 using CRATES. Contains a direct repeat and a RFP-dropout cassette.DepositorInsertsdirect repeat of SpCas9
promoter PJ23119
mRFP expression cassette
UseCRISPRExpressionBacterialPromoterBba_R0040 TetRAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-C
Plasmid#183539PurposeDeliver a split compact Prime Editor in vivoDepositorInsertC-terminal fragment of SpCas9 nickase (H840A), Reverse Transcriptase
UseAAVExpressionMammalianPromoterU1AAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_CDC7_sg1
Plasmid#254533PurposeCDC7 knockoutDepositorPublicationAvailable sinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_CDC7_sg2
Plasmid#254534PurposeCDC7 knockoutDepositorPublicationAvailable sinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only