We narrowed to 70,521 results for: gats
-
Plasmid#168519PurposeGateway-compatible Entry vectorDepositorInsertNSP2 (ORF1ab )
UseOtherAvailable SinceJan. 20, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-1 NSP6_nostop
Plasmid#168522PurposeGateway-compatible Entry vectorDepositorInsertNSP6 (ORF1ab )
UseOtherAvailable SinceJan. 20, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-1 NSP13_nostop
Plasmid#168528PurposeGateway-compatible Entry vectorDepositorInsertNSP13 (ORF1ab )
UseOtherAvailable SinceJan. 20, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENT-L1-Kozak-Ark-L2
Plasmid#186362PurposeEntry clone with ORF encoding Ciona robusta Aurora kinase A flanked by Gateway recombination sequences. No Stop sequence: to be recombined into a destination vector with a C-terminal protein tag.DepositorInsertCiona robusta Aurora kinase A
UseExpression of a fluorescent centrosome markerAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-HistoneH2B-L2
Plasmid#186357PurposeEntry clone with ORF encoding histone H2B flanked by Gateway recombination sequences. No Stop sequence: to be recombined into a destination vector with a C-terminal protein tag.DepositorInsertHistone H2B (H2BC11 Human)
UseExpression of a tagged nuclear markerAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
Plasmid#186413PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined NLSLacZ under control of an AttB3/B5 recombined reg. sequence.DepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330.puro sgRNA KGA Stop1
Plasmid#110405PurposeCRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistanceDepositorAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZA3
Plasmid#158481PurposeEntry clone for Golden Gate assembly. Golden Gate compatible A. thaliana ZAR1 L17E with STOP codonDepositorAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA2
Plasmid#158480PurposeEntry clone for Golden Gate assembly. Golden Gate compatible A. thaliana ZAR1 D489V with STOP codonDepositorAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA11
Plasmid#158489PurposeEntry clone for Golden Gate assembly. Golden gate compatible A. thaliana ZAR1 L17E without STOP codonDepositorAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA9
Plasmid#158487PurposeEntry clone for Golden Gate assembly. Golden gate compatible A. thaliana ZAR1 without STOP codonDepositorAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA4
Plasmid#158482PurposeEntry clone for Golden Gate assembly. Golden Gate compatible A. thaliana ZAR1 L17E/D489V with STOP codonDepositorAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA10
Plasmid#158488PurposeEntry clone for Golden Gate assembly. Golden gate compatible A. thaliana ZAR1 D489V without STOP codonDepositorAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA12
Plasmid#158490PurposeEntry clone for Golden Gate assembly. Golden gate compatible A. thaliana ZAR1 D489V/L17E without STOP codonDepositorAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-ICL1-LacI-Mit1AD
Plasmid#126721PurposeLacI-Mit1AD on pPICZ B expression vectorDepositorInserthybrid lacI-Mit1 activation domain coding sequence
ExpressionYeastPromoterICL1Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG SMAD4
Plasmid#83094PurposeGateway entry vector for inducible expression of human SMAD4 with N-terminal 3xFLAG tagDepositorInsertSMAD4 (SMAD4 Human)
UseEntry vector for gateway cloningTags3xFLAGPromoterTRE tight promoterAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB418
Plasmid#68683PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB421
Plasmid#68686PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-HKU1-Hemagglutinin-esterase
Plasmid#168902PurposeGateway-compatible Entry vectorDepositorInsertHCoV-HKU1-Hemagglutinin-esterase (HE )
UseGateway-compatible entry vectorMutationCodon optimized (H.sapiens)Available SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
CaV1.2/pcDNA3.1~ Human
Plasmid#140576PurposeExpression in mammallian cells or oocytesDepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
p5E TRE-3GV (JDW 1163)
Plasmid#224476PurposeGateway compatible 5' entry clone containing a 3rd generation Tet-On promoterDepositorInsertTRE3GV promoter
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 (1-695)/pcDNA3.1
Plasmid#111453PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
Tags8xHis and EGFPExpressionMammalianMutationKv7.4 (1-695)Available SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC49
Plasmid#133060PurposeLentiviral vector with a (Ubiquitous Chromatin Opening Element) UCOE upstream of a CAG promoter constitutively expressing a single insert containing the Tau.K18(P301L/V337M)-mScarlet-I fusion protein.DepositorInsertTau.K18(LM)
UseLentiviralTagsmScarletIExpressionMammalianPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hygro-Cas9 donor
Plasmid#86883PurposeDonor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus with hygromycin selectionDepositorInserthSpCas9
UseCRISPRTags3xFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
p5E--3mnx1
Plasmid#74632PurposeCan be used to drive expression specifically in zebrafish motor neuronsDepositorInsertmotor neuron and pancreas homeobox 1 promoter (mnx1 Zebrafish)
Use5' entry vector for multisite gateway three …Promoter-3mnx1Available SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-GABARAPL2 G116A
Plasmid#123104PurposeExpresses 3xFLAG-GABARAPL2 G116A in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
Tags3xFLAGExpressionMammalianMutationGlycine 116 to AlaninePromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pME-MCS (JDW 455)
Plasmid#229832PurposeA gateway compatible middle entry clone containing an MCS (mutiple cloning site).DepositorInsertattL1/L2 flanked MCS
UseGateway entry cloneAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-mmCdh5pro (JDW 1239)
Plasmid#224478PurposeGateway compatible 5' entry clone containing the Murine Cdh5 promoterDepositorInsertCdh5 promoter
ExpressionMammalianAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-H2A_mCherry_SV40pA (JDW 967)
Plasmid#224528PurposeA Gateway compatible 3' entry clone containing an H2A mCherry fusion followed by SV40 late polyADepositorInsertH2A-mCherry-SV40pA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rabbit GFP Cav 2.2 pMT2
Plasmid#58737Purposeexpression of GFP tagged rabbit Cav2.2 in mammalian cellsDepositorAvailable SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGMβ1
Plasmid#216202PurposeChromosomal gene manipulation (gene insertion, conversion, deletion) of dairy used Lactobacillus bulgaricus, a difficult gene to manipulate, is now possible by conjugation using this pGMB1 plasmid.DepositorTypeEmpty backboneUseShuttle vector, conjugal plasmid, theta type rep…ExpressionBacterialPromoterlac promoter in pGEM-Teasy, Promoters in pAMbeta1…Available SinceJan. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Kv7.1/pcDNA3.1
Plasmid#111452PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 1 isoform 1 [Homo sapiens] (KCNQ1 Human)
Tags8xHis and EGFPExpressionMammalianAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR-attL5-CRY2-mCh-attL2
Plasmid#160438PurposeEntry vector for cloning Cryptochrome2-mCherry using 2-fragment gateway recombinationDepositorAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mKate2
Plasmid#162624PurposeAllows for transcription of mKate2 control for injection into zebrafish embryos for BiFC assaysDepositorInsertmKate2
ExpressionMammalianPromoterSP6Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-Hemagglutinin-esterase
Plasmid#168943PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-Hemagglutinin-esterase (HE )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-hApg5(K130R)-HA
Plasmid#22949DepositorInsertHomo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae) (ATG5 Human)
Tags3xHAExpressionMammalianMutation130 Lysine to ArginineAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA pCAGGS
Plasmid#206076Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and an exofacial double HA tag in domain IIDepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p5E-CAGGS (JDW 912)
Plasmid#224472PurposeGateway compatible 5' entry clone containing the CAG promoter for constitutive expression of downstream constructs.DepositorInsertCAGGS Promoter
ExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME V5-mTagBFP2 (JDW 830)
Plasmid#224484PurposeGateway compatible middle entry clone containing V5 tagged mTagBFP2 (Cytosolic blue fluorescent reporter)DepositorInsertV5-mTagBFP2
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-V5-mScarlet-I_SV40pA (JDW 968)
Plasmid#224529PurposeA Gateway compatible 3' entry clone containing an V5 mScarlet fusion followed by SV40 late polyADepositorInsertV5-mScarlet-I
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS405 PEX14-VAC8-RFP
Plasmid#166844PurposeExpresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORFDepositorTagsPEX14 transmembrane domain and RFPExpressionYeastMutationPEX14 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
[pSK497] pLJC5 Flag-Depdc5(AB)
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only