We narrowed to 2,603 results for: pCas
-
Plasmid#154430Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vectorDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
UseAAV and CRISPRExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnCas9-miniSdd7-PBE
Plasmid#204859PurposeFor cytosine base editing using miniSdd7 in monocotyledon plants (transient transformation)DepositorInsertminiSdd7-nSpCas9(D10A)-UGI
UseCRISPRExpressionPlantMutationD10A in SpCas9PromoterZmUbi-1Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330 EGFR-sgRNA
Plasmid#188633PurposeA human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFRDepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Td-CBEmax
Plasmid#196600PurposeMammalian expression of Td-CBEmaxDepositorInsertbpNLS-TadA-8e (N46L/E27R)-32aa linker-nSpCas9-bpNLS-P2A-UGI-bpNLS
Tags6*HisExpressionMammalianMutationTadA-8e (N46L/E27R); S. pyogenes Cas9 (D10A)Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-SPdCas9-DNMT3B-2A-Blast
Plasmid#71217PurposedCas9 fused to human DNMT3B catalytic domainDepositorInsertdSpCas9-DNMT3B catalytic domain
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAID6
Plasmid#136989PurposeYeast integration plasmid for expression of dLbCpf1-VP, dSpCas9-RD1152, SaCas9, and Csy4DepositorInsertsdLbCpf1-VP
dSpCas9-RD1152
SaCas9
Csy4
ExpressionYeastPromoterENO2, TDH3, TEF1, and TPI1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWS3799-gRNA-Csy4-template
Plasmid#182827PurposeSpCas9 gRNA-Csy4 templateDepositorInsertSpCas9 gRNA scaffold + Csy4 sequence
UseCRISPRAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-2
Plasmid#86925PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-1
Plasmid#86924PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
ABE8e-dimer
Plasmid#138490PurposeA-to-G base editorDepositorInsertecTadA(WT)-ecTadA(8e)-nSpCas9
ExpressionMammalianAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A(E752A)
Plasmid#71213PurposedCas9 fused to BFP and the human DNMT3A catalytically inactive domainDepositorInsertdSpCas9-BFP-DNMT3A(E752A), DNMT3A catalytic domain with inactivation mutation E752A
TagsdSpCas9-BFP-DNMT3A(E752A)ExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE
Plasmid#139086PurposeExpresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSN061
Plasmid#101725PurposeSingle copy yeast plasmid expressing Cas9 from Streptococcus pyogenes (SpCas9), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsS. pyogenes Cas9 codon optimized for expression in S. cerevisiae. (NEWENTRY )
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAEL006511-Cas9
Plasmid#100580PurposeThe promoter of AAEL006511 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL006511-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL006511 and Opie2Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
rGluA1 (px330:2-guideCas9)
Plasmid#169437PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRExpressionMammalianAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6GRNA
Plasmid#68370PurposegRNA scaffold with hU6 promoterDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only