We narrowed to 8,876 results for: sgrna
-
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPP21 (pAVA3259)
Plasmid#239327PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPP21DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPP21 (RPP21 Human)
UseCRISPR and LentiviralAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNS1D-sgRNA9-SpR
Plasmid#191092PurposeaTc inducible gRNA expression plasmid with BbsI sites for Golden Gate insertion of crRNA oligos and homology arms for genome integration at NS1D in Synechococcus sp. PCC 7002DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromotertetAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-sgRNA GLB1
Plasmid#184378PurposeExpresses a sgRNA to edit GLB1 gene NM_000404.2_c.907A>GDepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_BRF2 (pAVA3258)
Plasmid#239326PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting BRF2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting BRF2 (BRF2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPPH1 (pAVA3586)
Plasmid#239328PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1 (RPPH1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_D11 (pAVA3773)
Plasmid#239310PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and a non-targeting sgRNA as control(-)DepositorInsertU6-driven non-targeting sgRNA Control(-)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_POP1 (pAVA3497)
Plasmid#239311PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP1DepositorInsertU6-driven sgRNA targeting POP1 (POP1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP38 (pAVA3523)
Plasmid#239313PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP38DepositorInsertU6-driven sgRNA targeting RPP38 (RPP38 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only