We narrowed to 4,733 results for: Gca
-
Plasmid#173658PurposeExpresses a Tsc1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tsc1 (Tsc1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIAS-1
Plasmid#184478PurposeLentivirus gRNA targeting human LIAS geneDepositorInsertLIAS (LIAS Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-dADAM17 (#1)
Plasmid#177259PurposeA knockout vector for the dog Adam17DepositorInsertA gRNA targeting the dog Adam17 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGMC00005
Plasmid#166722PurposesgRNA against human ASNSDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSUPER.retro.puro-shMePCE
Plasmid#113536PurposeRetroviral vector designed to knock down MePCE.DepositorInsertshMePCE (MEPCE Human)
UseRetroviralAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_BCL6_iso1_2
Plasmid#104047PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZGPAT_1
Plasmid#86327PurposeEncodes gRNA for 3' target of human ZGPATDepositorInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR14.483
Plasmid#39544DepositorAvailable SinceSept. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLP110_AAV Scramble Control
Plasmid#239418PurposeNegative control AAV vector for SaCas9-based CRISPR KODepositorInsertScramble control
UseAAVAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
Plasmid#231400PurposeKnockdown of DRD1 across rodent speciesDepositorInsertsgRNA(DRD1.2)
UseAAV and CRISPRExpressionMammalianPromoteru6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_1
Plasmid#232309PurposeHuman ETFDH Gene Knockout (gRNA 1)DepositorInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i3-ipUSEPR-TR657
Plasmid#228929PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i3 (Trp53 Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCYFIP1-2
Plasmid#210138Purposeknock out CYFIP1 in mammalian cellsDepositorInsertCytoplasmic FMR1-interacting protein 1 (CYFIP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS23.U6<ActB.mus_C-term-KI_gRNA
Plasmid#207408PurposegRNA from a U6 promoter targeting the mouse ActB near the 3' end of the ORF. Used for C-terminal knockin by DSB repair. [Lab plasmid ID: TU260]DepositorInsertActB
UseCRISPR and Mouse TargetingPromoterU6Available SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL049
Plasmid#198809PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity.DepositorInsert15xUAS::GCaMP6s-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 ShCavin1-EGFP
Plasmid#187253PurposeLentiviral expression of shRNA targeting Cavin1DepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#1/Cre
Plasmid#173643PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCB320-sgNC.ACOCA
Plasmid#169836PurposeExpresses a negative control sgRNADepositorInsertsafe harbor sgRNA
UseCRISPR, Lentiviral, and Mouse TargetingExpressionMammalianPromotermU6Available SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
AllCB shRNA-1
Plasmid#160065PurposeKnock Down all Collybistin isoformsDepositorAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
BC1364-mouse U6-sgH2B
Plasmid#164043PurposeU6-driven sgRNA targeting H2BDepositorInsertH2B targeting sgRNA
UseCRISPRPromotermouse U6Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb2-GFP KI
Plasmid#139661PurposeEndogenous tagging of CaVβ2: C-terminal (amino acid position: Q655)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEPG_shSik3.308
Plasmid#125878PurposeRetroviral expression of mouse Sik3 shRNA with GFP and puromycin resistance geneDepositorInsertshRNA targeting Sik3
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5.1.0-gDNA
Plasmid#112399PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB5DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgSORCS2-G2
Plasmid#118416PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2DepositorInsertgRNA SORCS2 Human (SORCS2 Human)
UseCRISPR and LentiviralAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only