We narrowed to 39,295 results for: NAM
-
Plasmid#215458PurposeExpression vector with Dok1DepositorAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
FLuc-C-HiBiT
Plasmid#207118PurposeBacterially expressed FLuc-HiBiT for Ni-NTA purificationDepositorInsertluciferin 4-monooxygenase
TagsHiBiT Tag and His-tag with thrombin siteExpressionBacterialMutationCodon optmization for expression in BL21DE3PromoterT7 PromotorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_Z11 gpN:SpyTag
Plasmid#225196PurposeUsed for adding C-terminal SpyTag to the Plesiomonas ZOR0011 P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆tum
Plasmid#225198PurposeUsed to create a markerless deletion of the E. coli HS tum geneDepositorInserttum homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_lexA(Ind-)
Plasmid#225199PurposeUsed to create a non-inducible lexA by introducing a G85D mutation in E. coli HSDepositorInsertlexA homology arms
ExpressionBacterialMutationlexA G85DAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_gpN:SpyTag
Plasmid#225193PurposeUsed for adding C-terminal SpyTag to the E. coli HS P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-2
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
ExpressionBacterialAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ER-frNFAST
Plasmid#233599PurposeExpression of frNFAST on the ER membraneDepositorInsertfrNFAST
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PM-frNFAST
Plasmid#233602PurposeExpression of frNFAST on the PM facing the cytosolDepositorInsertfrNFAST
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-Jarid2-polyA
Plasmid#223811PurposeIVT of Flag-Jarid2 mRNA with polyA tail, by the T7 promoter.DepositorInsertJarid2 (Jarid2 Mouse)
UseIn vitro transcriptionTagsFlagExpressionMammalianPromoterCMV, T7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIN3 (gpdA-cTerm-Citrine2-ptrA)
Plasmid#188737PurposeExpresses Citrine2 for C-terminal taggingDepositorInsertgdpA-Citrine2 PtrA
UseFilamentous fungal expressionTagsCitrine2Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN4 (gpdA-nTerm-Citrine2-ptrA)
Plasmid#188738PurposeExpresses Citrine2 for N-terminal taggingDepositorInsertgdpA-Citrine2 PtrA
UseFilamentous fungal expressionTagsCitrine2Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN5 (gpdA-cTerm-mTurqoise2-ptrA)
Plasmid#188739PurposeExpresses mTurqoise2 for C-terminal taggingDepositorInsertgdpA-mTurquoise PtrA
UseFilamentous fungal expressionTagsmTurquoiseAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIN6 (gpdA-nTerm-mTurqoise2-ptrA)
Plasmid#188740PurposeExpresses mTurqoise2 for N-terminal taggingDepositorInsertgdpA-mTurqoise2 PtrA
UseFilamentous fungal expressionTagsmGreenlanternAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB50
Plasmid#226311PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-7
ExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB55
Plasmid#226310PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-5
ExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETSUMO2_Ideonella-bGSDM-WELQ
Plasmid#222098PurposeFor expression of a mutant bacterial gasdermin (bGSDM) encoded by a Ideonella species with a WELQut protease cleavage site for controlled activation.DepositorInsertIdeonella-bGSDM-WELQ ORF
Tags6xHis-SUMO2ExpressionBacterialMutationN-terminal methionine deleted and replaced by sin…PromoterT7Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP10A(E203Q)-HA
Plasmid#209258PurposeMammalian expression of ATP10A mutant E203QDepositorAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG/ATP10A(E203Q)-HA
Plasmid#209246PurposeMammalian expression of ATP10A mutant E203QDepositorAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-R-iLACCO1.2
Plasmid#208021PurposeBiosensor for intracellular L-lactateDepositorInsertR-iLACCO1.2
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-R-diLACCO1
Plasmid#208022PurposeControl biosensor for intracellular L-lactateDepositorInsertR-diLACCO1
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-deLACCO1
Plasmid#208018PurposeControl biosensor for extracellular L-lactateDepositorInsertdeLACCO1
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-R-iLACCO1
Plasmid#208019PurposeBiosensor for intracellular L-lactateDepositorInsertR-iLACCO1
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMVQA
Plasmid#197894PurposepCR®2.1-TOPO® backbone with 3' end of HIV-1(HXB2:9045 till poly-A (20))DepositorInsertHIV-1 3' end (HXB2: 9045 till poly-A(10)
ExpressionBacterialAvailable SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
TEG +Q111T
Plasmid#187435PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectMutationchanged glutamine at 117 to threoninePromoterPH and p10Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA16-Ubc-NLS-HA-dSaCas9-NLS-[10XGCN4]-P2A-BSD
Plasmid#199447PurposeExpession of dSaCas9-10XGCN4 that recruits scFV-tdTomato (pCA15) for amplifying fluorescent signalDepositorInsertdSaCas9-10xGCN4
UseLentiviralExpressionMammalianPromoterhuman ubiquitin C (UBC)Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTA1cI-T3
Plasmid#193789PurposeExpresses truncated version of lambda CI named T3 under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertTruncated version of Lambda CI, named T3, where the first two codons are deleted
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA3_dTet_mTurquoise2
Plasmid#189806PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA3 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA2_dTet_mTurquoise2
Plasmid#189805PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA2 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA1_dTet_mTurquoise2
Plasmid#189804PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA1 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-GFP ArgSen delta Degradation Domain
Plasmid#184692PurposeLentiviral transfer plasmid for expression of GFP ArgSen delta Degradation DomainDepositorInsertGFP ArgSen delta Degradation Domain
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-GFP ArgSen delta Disordered Region
Plasmid#184693PurposeLentiviral transfer plasmid for expression of GFP ArgSen delta Disordered RegionDepositorInsertGFP ArgSen delta Disordered Region
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-GFP ArgSen delta Rad23b UbL
Plasmid#184694PurposeLentiviral transfer plasmid for expression of GFP ArgSen delta Rad23b UbLDepositorInsertGFP ArgSen delta Rad23b UbL
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP ArgSen delta Degradation Domain
Plasmid#184701PurposeLentiviral transfer plasmid for expression of GFP ArgSen delta Degradation DomainDepositorInsertGFP ArgSen delta Degradation Domain
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP ArgSen delta Disordered Region
Plasmid#184702PurposeLentiviral transfer plasmid for expression of GFP ArgSen delta Disordered RegionDepositorInsertGFP ArgSen delta Disordered Region
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB116.2
Plasmid#181946PurposeaTc-inducible expression of TorR with C-terminal mNeonGreen fusion. Also contains mCherry under TorR-controlled promoter PtorCAD129DepositorInsertTagsmNeonGreenExpressionBacterialPromoterTorR-mNG-PLtetO-1; mCherry-PtorCAD129; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB120.2
Plasmid#181947PurposeaTc-inducible expression of TorR with N-terminal mNeonGreen fusion. Also contains mCherry under TorR-controlled promoter PtorCAD129DepositorInsertTagsmNeonGreenExpressionBacterialPromotermNG-TorR-PLtetO-1; mCherry-PtorCAD129; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 PhoP-Salmonella enterica subsp. enterica serovar Typhimurium, Synthetic)
TagsmNeonGreenExpressionBacterialPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
TEG +H122D
Plasmid#187434PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectMutationchanged histidine at 128 to aspartic acidPromoterPH and p10Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP2
Plasmid#178969PurposeExpresses miRFP2 in worm cellsDepositorInsertwmiRFP2
TagsnoExpressionWormMutationNOPromotertag-168 promoterAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-10-mCherry-R11b
Plasmid#179891PurposeDonor with homologous arms for Rab11b to knock in mCherryDepositorInsertRAB11B, member RAS oncogene family (RAB11B Human)
UseCRISPR; Donor for homologous based knock inTagsmCherryExpressionBacterial and MammalianAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2
Plasmid#71348PurposegltA1-gltA2 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
eNS2B47NS3 S135A
Plasmid#155318PurposeDENV4 47 peptides from NS2B cofactor linked to NS3 full length by VKTQR linker S135A mutantDepositorInsertDENV4 NS3 full length protein linked with 47 peptides from NS2B cofactor
TagsHis tagExpressionBacterialMutationS135APromoterM13Available SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET15b-GreBdm-D41N
Plasmid#129691Purposeexpress E. coli GreB E82C/C68S/D41NDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMJA105
Plasmid#128521PurposeExpresses amyloid human Lysozyme in Pichia pastorisDepositorAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p415 δCLD2α
Plasmid#73874PurposeδCLD2α - His tagged (μHD deleted)DepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM5081
Plasmid#85107PurposePtrc-yfp-kaiC expressed from NSI-SpSm vector constructed by seamless assembly. Subcloned from pAM5080. Functional fusion expressed as full-length fusion protein expressed at WT levels.DepositorInsertYFP-KaiC
TagsYFPExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-FLAG-LINXa4-Bre1
Plasmid#73617PurposeControl of the E3 ligase Bre1 with LINXa in yeast.DepositorInsertLINXa4-Bre1dNLS
UseSynthetic BiologyTagsFLAGExpressionYeastMutationBre1 point mutations K8A, K9A and K11APromoterADH1Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Rm_AE
Plasmid#66065PurposeMoClo Transcriptional Unit: FACS Standard Color Controls - High RFP expression cassette - Kanamycin plasmid [A:J23102:B:BCD2:C:E1010m:D:B0015:E]DepositorInsertFACS Controls
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only