We narrowed to 11,695 results for: nar
-
Plasmid#218278PurposeIntroduction of a LowTempGAL Turbo module (GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHDGAL3C
Plasmid#218276PurposeIntroduction of a LowTempGAL Turbo module (HD-GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2> UBI4>RHGSGTMV>DHFRP66L>G*6>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P), DHFR (P66L)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL3C
Plasmid#218275PurposeIntroduction of a LowTempGAL Turbo module (GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1553 pLenti-U1a-SpCas9-miniU6-tracrRNA
Plasmid#211819Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line extablishmentDepositorInsertSpCas9, tracrRNA and blasticidin resistance gene
UseLentiviralExpressionMammalianPromoterU1a promoter and miniU6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS2194-RP_PiggyBac_SpCas9ABE8e-tracrRNA-Puro
Plasmid#211821PurposePiggyBac vector expressing SpCas9-ABE8e with tracrRNA for stable cell line establishmentDepositorInsertSpCas9-ABE8e, tracrRNA and Puromycin resistance gene
ExpressionMammalianPromoterchicken β-actin promoter, U6 promoter and hPGK pr…Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
Plasmid#211815Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishmentDepositorInsertSpCas9, tracrRNA and puromycin selection gene
UseLentiviralExpressionMammalianPromoterU1a promoter, U6 promoter, and hPGK promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMDS 2 colors
Plasmid#206265PurposeExpression of 2 fluorescently labelled proteins in mammalian cells. Can be used as a CRE-donor (MultiBac system)DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 HITI-2c ACTB
Plasmid#206269PurposeENTR Vector 1 for MultiSite Gateway assembly. Encodes HITI-2c donor for ACTB C-terminal tagging (mCherry T2A Puro) in human cellsDepositorInsertHITI-2c donor
UseCRISPR; Multimate/gateway entr 1ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-PE2 HEK3
Plasmid#206274PurposeVector for the production of recombinant baculovirus using MultiMate assembly. All-in-one vector for PE2 HEK3 prime editing. CRE-Acceptor in MultiBac system.DepositorInsertPE2 (synthetic), hU6 HEK3 PegRNA, hU6 HEK3 sgRNA, aeBlue (E. quadricolor), VSV-G, TagBFP
UseCRISPR; Recombinant baculovirus production, cre-a…ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV PE2
Plasmid#206276PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes PE2 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertPE2
UseCRISPR; Recombinant baculovirus production, multi…ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENeCFPCNAL2 pc922
Plasmid#167563PurposeFor construction of CFP-tagged human PCNA, the GFP coding sequence in the pENeGFPCNAL2 vector was replaced by the ECFP coding sequence from the pECFP-C1 vector (Clontech Laboratories, Inc., CA).DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-CeAIN2_254-400-DmGW182_635-1384-CIM1-P-GLmut-F961A_S
Plasmid#147515PurposeInsect Expression of CeAIN2_254-400-DmGW182_635-1384-CIM1-P-GLmut-F961ADepositorInsertCeAIN2_254-400-DmGW182_635-1384-CIM1-P-GLmut-F961A (gw Human, Nematode)
ExpressionInsectMutationDeletion of 2 AA (SD) at position 378-379 compare…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-HsTNRC6A_1209-1709-M2WA-CIM1-2mut-F1359A_S
Plasmid#147512PurposeBacterial Expression of HsTNRC6A_1209-1709-M2WA-CIM1-2mut-F1359ADepositorInsertHsTNRC6A_1209-1709-M2WA-CIM1-2mut-F1359A (TNRC6A Human)
ExpressionBacterialMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-CeAIN2_254-400-DmGW182_635-1384-M2WA-CIM1mut-F961A_R
Plasmid#147389PurposeInsect Expression of CeAIN2_254-400-DmGW182_635-1384-M2WA-CIM1mut-F961ADepositorInsertCeAIN2_254-400-DmGW182_635-1384-M2WA-CIM1mut-F961A (gw Nematode, Fly)
ExpressionInsectMutationDeletion of 2 AA (SD) at position 378-379 compare…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-CeAIN2_254-400-DmGW182_635-861_R
Plasmid#147404PurposeInsect Expression of CeAIN2_254-400-DmGW182_635-861DepositorInsertCeAIN2_254-400-DmGW182_635-861 (gw Nematode, Fly)
ExpressionInsectMutationDeletion of 2 AA (SD) at position 378-379 compare…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-CeAIN2_254-400-DmGW182_635-1384_R
Plasmid#147405PurposeInsect Expression of CeAIN2_254-400-DmGW182_635-1384DepositorInsertCeAIN2_254-400-DmGW182_635-1384 (gw Nematode, Fly)
ExpressionInsectMutationDeletion of 2 AA (SD) at position 378-379 compare…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
ExpressionMammalianMutationChanged Valine 337 to MethinonineAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-UbC-3xNLS-mScarlet-I
Plasmid#191099PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet-I
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationoptimized to human codon usagePromoterUbCAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Neo
Plasmid#186672PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. Neomycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Neomycin (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Hygro
Plasmid#186668PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, hygromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Hygromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_ANKRD1_sgRNA2
Plasmid#186669PurposePlasmid containing Cas9 and ANKRD1 sgRNA2 , sgRNA sequence: cggtcagcttatatagct.DepositorInsertANKRD1 KO sgRNA Plasmid (ANKRD1 Human)
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(K206A/K244A/L301R/V303R/V306R)
Plasmid#177138PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(K206A/K244A/L301R/V303R/V306R) with a TEV protease site located between the GST tag and PolB(K206A/K244A/L301R/V303R/V306R)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(L301R/V303R/V306R)
Plasmid#177137PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(L301R/V303R/V306R) with a TEV protease site located between the GST tag and PolB(L301R/V303R/V306R)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(K206A/K244A/T304I)
Plasmid#177134PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(K206A/K244A/T304I) with a TEV protease site located between the GST tag and PolB(K206A/K244A/T304I)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD443
Plasmid#168469PurposeFor the insertion pf NLS-mScarlet-I-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mScarlet-I-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263E
Plasmid#141340PurposeLentiviral vector for expression of human NHEJ1-S263E in mammalian cellsDepositorInsertNHEJ1-S263E (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263EPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263A
Plasmid#141341PurposeLentiviral vector for expression of human NHEJ1-S263A in mammalian cellsDepositorInsertNHEJ1-S263A (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263APromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA901: pMVP (L3-L2) HA tag + pA; EF1a::eGFP-P2A-TETa-pA
Plasmid#121804PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + EF1a-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream EF1a-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + EF1a::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA701: pMVP (L3-L2) HA tag + pA; RIP::eGFP-P2A-TETa-pA
Plasmid#121808PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + RIP-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream RIP-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + RIP::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Wing
Plasmid#124552PurposeChimeric ETS domain: Wing of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationThe 5 residues making up the "wing" in …Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library 1
Pooled Library#168776PurposePooled library expressing barcoded SARS-CoV-2 RNA Binding Domain mutationsDepositorExpressionYeastSpeciesSars-cov-2Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library 2
Pooled Library#168777PurposePooled library expressing barcoded SARS-CoV-2 RNA Binding Domain mutationsDepositorExpressionYeastSpeciesSars-cov-2Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library N501Y Tile 2 (positions 437-527)
Pooled Library#174296PurposeThis library contains mutations to SARS-CoV-2 Spike RBD N501Y variant in which all surface exposed residues on S RBD (Tile 2, positions 437-527) were mutated to every other amino acid.DepositorExpressionYeastAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library N501Y Tile 1 (positions 333-436)
Pooled Library#174295PurposeThis library contains mutations to SARS-CoV-2 Spike RBD N501Y variant in which all surface exposed residues on S RBD (Tile 1, positions 333-436) were mutated to every other amino acid.DepositorExpressionYeastAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library E484K Tile 2 (positions 437-527)
Pooled Library#174294PurposeThis library contains mutations to SARS-CoV-2 Spike RBD E484K variant in which all surface exposed residues on S RBD (Tile 2, positions 437-527) were mutated to every other amino acid.DepositorExpressionYeastAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike (S) Receptor Binding Domain (RBD) library E484K Tile 1 (positions 333-436)
Pooled Library#174293PurposeThis library contains mutations to SARS-CoV-2 Spike RBD E484K variant in which all surface exposed residues on S RBD (Tile 1, positions 333-436) were mutated to every other amino acid.DepositorExpressionYeastAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD765 TRE3GV MCS in TU1
Plasmid#139253PurposeTRE3GV promoter and an MCS in TUPV1DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD767 TRE3GV MCS in TU4
Plasmid#139256PurposeTRE3GV promoter and an MCS in TUPV4DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1159 pLink 9
Plasmid#139247PurposeVector that holds the linker for circuits with 9 TUsDepositorInsertLinker9
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1158 pLink 8
Plasmid#139246PurposeVector that holds the linker for circuits with 8 TUsDepositorInsertLinker8
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1157 pLink 7
Plasmid#139245PurposeVector that holds the linker for circuits with 7 TUsDepositorInsertLinker7
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1156 pLink 6
Plasmid#139244PurposeVector that holds the linker for circuits with 6 TUsDepositorInsertLinker6
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1155 pLink 5
Plasmid#139243PurposeVector that holds the linker for circuits with 5 TUsDepositorInsertLinker5
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only