1,782 results
-
Plasmid#191477PurposePacr-2s-Arch::wCherry unc-54 3' UTR C.elegans A/B MN expression of Arch RFPDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLJ57 (Pmec-17_GCaMP8f_SL2_mKate2_let-858_3'UTR)
Plasmid#239865Purposeexpression of GCaMP8f in C. elegans under mec-17-promoter controlDepositorInsertsGCaMP8f
mKate2
Tags6xHisExpressionWormMutationcodon optimized with introns for C. elegansPromotermec-17Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCFJ782 - HygroR
Plasmid#190933PurposeHygromycin resistance co-injection markerDepositorInsertHygromycin resistance gene
ExpressionWormPromoterrps-0Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP680-T2A-HO1
Plasmid#197244PurposeExpresses the protein of wmiRFP680-T2A-HO1 in neurons of C eleganDepositorInsertwmiRFP680-T2A-HO1
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEM318 - sgRNA mosTI unc-119 single-copy
Plasmid#159822PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 single-copy
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP670-2-T2A-HO1
Plasmid#197250PurposeExpresses the protein of wmiRFP670-2-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP670-2-T2A-HO1
ExpressionWormAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEM246 - mosTI - unc-119 - MCS
Plasmid#182343PurposeEmpty cloning vector for mosTI(unc-119). MCS or Golden Gate (BsaI: tgcc - MCS - gagc)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM319 - array co-injection fragment mosTI unc-119
Plasmid#159823PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertarray co-injection fragment mosTI unc-119
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDJ231 - Phsp Cas9
Plasmid#191382PurposeHeat shock inducible Cas9 expression in C. elegans.DepositorInsertPhsp-16.41 Cas9 gpd-2 tagRFP-t
UseCRISPRExpressionWormPromoterPhsp-16.41Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM371 - ce-unc-119 array integration
Plasmid#182640PurposeCo-injection fragment for extra-chromosomal array integration at ce-unc-119 locusDepositorTypeEmpty backboneExpressionWormAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM320 - sgRNA mosTI unc-119 array insertion
Plasmid#159824PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 array insertion
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1137
Plasmid#84827PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSEM376 - sgRNA - spc4 - array - insertion - unc-119 - locus
Plasmid#182344PurposesgRNA4 for insertion of extrachromosomal arrays into the ce-unc-119 genomic locus. Use with pSEM371 fragment included in Ex array.DepositorInsertSpacer 4
ExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM253 - sgRNA mosTI hygroR
Plasmid#159827PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertsgRNA mosTI hygroR
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM272 - MCS mosTI Pmlc-2_GFP target
Plasmid#159834PurposeSingle copy or array insertion by MosTI using split Pmlc-2 GFP selectionDepositorInsertMCS mosTI Pmlc-2_GFP target
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM270 - MCS mosTI hygroR target
Plasmid#159826PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertMCS mosTI hygroR target
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM255 - sgRNA mosTI Pmlc-2_GFP
Plasmid#159835PurposeSingle copy or array insertion by MosTI using split Pmlc-2 GFP selectionDepositorInsertsgRNA mosTI Pmlc-2_GFP
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM264 - pDESTR4-R3 mosTI Pmlc-2_GFP target
Plasmid#159842PurposeSingle copy or array insertion by MosTI using split Pmlc-2 GFP selectionDepositorInsertpDESTR4-R3 mosTI Pmlc-2_GFP target
ExpressionWormMutationNot applicableAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only