We narrowed to 1,494 results for: U6 promoter
-
Plasmid#178100PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and EBFP_To_EGFP pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9
Plasmid#162162PurposeExpresses hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTagsN/AExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-EGFP_cU6:6-sgRNA
Plasmid#190597PurposeThe plasmid encodes S. pyogenes Cas9 and eGFP separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoter.DepositorInsertsCas9
sgRNA
UseCRISPRTagsEGFP - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shCTRL
Plasmid#181875PurposeExpresses a control shRNA with no known targets in the mouse genome under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertcontrol shRNA with no known targets in the mouse genome
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G2_Dual_sgRNA
Plasmid#173201PurposeCoselection for ABE or NHEJ in human cells. Vector for tandem expression of ATP1A1 G2 sgRNA with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA
UseCRISPRExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-3gRNA
Plasmid#183914PurposegRNA-expressing plasmid under Aedres aegypti AAEL017763 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017763)Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIK208
Plasmid#65630PurposesgRNA targeting dpy-10 (Arribere et al., 2014) expressed from a C. elegans U6 promoter (Friedland et al., 2013), in a "flipped and extended" sgRNA backbone (Chen et al., 2013)"DepositorInsertU6 promoter::dpy-10 sgRNA with a "flipped and extended" sgRNA backbone
UseCRISPRExpressionWormAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#178107PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-53 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_E2419K_Dual_pegRNA
Plasmid#178110PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-E2419K pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPshRNA1
Plasmid#126611PurposeExpresses shRNA against human CNP under mouse U6 promoterDepositorAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_RUNX1_Nick-38_Dual_sgRNA
Plasmid#173214PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and RUNX1 nick-38 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + RUNX1 Nick-38 sgRNA
UseCRISPR; Prime editing (pe3)ExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-2
Plasmid#121423PurposesgYAP-2 sequence: GAGATGACTTCCTGAACAGTG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-2
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-1gRNA
Plasmid#183912PurposegRNA-expressing plasmid under Aedes aegypti AAEL017702 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017702)Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-2gRNA
Plasmid#183913PurposegRNA-expressing plasmid under Aedres aegypti AAEL017774 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017774)Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EBFP_Nick_Dual_sgRNA
Plasmid#178094PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and EBFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EBFP nick sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EGFP_Nick_Dual_sgRNA
Plasmid#178095PurposeControl vector for coselection for PE3b in human cells. Tandem expression of ATP1A1 G3 and EGFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EGFP nick sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178096PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA
Plasmid#178108PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_F2108L_Dual_pegRNA
Plasmid#178109PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_E2419K_Dual_pegRNA
Plasmid#173209PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR E2419K pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-U6insert
Plasmid#104536PurposeA piggybac vector with a U6 promoter that allows cloning of guide RNAsDepositorTypeEmpty backboneUseCRISPR, Mouse Targeting, and Synthetic Biology ; …ExpressionMammalianPromoterU6Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti guide ds red
Plasmid#128055PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and DsREd from EF-1a promoter. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgBart10-5p)-PGKpuro2ABFP-W
Plasmid#252920PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorInsertEBV-miR-Bart10-5p
UseCRISPRPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA_Cloning Vector BbsI
Plasmid#128433PurposeEmbty backbone vector for expression of gRNA for spCas9 genome editing or epigenome editingDepositorTypeEmpty backboneExpressionMammalianPromoterU6 promoterAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6_AluJb
Plasmid#240314PurposeOverexpress the consensus AluJb retrotransposon sequence from a Pol-III promoterDepositorInsertAluJB
ExpressionMammalianPromoterU6Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Dual_pegRNA
Plasmid#173200PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-1
Plasmid#121533PurposesgITGB1-1 sequence: GAAGCAGGGCCAAATTGTGGG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only