We narrowed to 7,769 results for: aav
-
Plasmid#205310PurposeProduction of AAV particles encoding WHaloCaMP1a from the CaMKII promoterDepositorInsertWHaloCaMP1a
UseAAVAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-iRFP
Plasmid#64887PurposeMarking retinal neurons with infrared fluorescent proteins (iRFP) to preserve photoresponsivenessDepositorInsertiRFP
UseAAVExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E22-ChR2GFP2x
Plasmid#153436PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E22 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-tdKatushka2-WPRE
Plasmid#193344PurposeAAV-mediated expression of tdKatushka2 under the TRE promoter in mammalian cellsDepositorInserttdKatushka2
UseAAVExpressionMammalianPromoterTREAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Gfa104-jGCaMP8m
Plasmid#254432PurposeFor production of AAV containing jGCaMP8mDepositorInsertmedium fast calcium green fluorescent indicator
UseAAVPromoterGfa104Available SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-GFP
Plasmid#118270PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-Ef1a-DIO hChR2(E123A)-mCherry
Plasmid#35508PurposeAAV expression of EF1a-driven, cre-dependent, hChR2 variant CheTA 2.0 for ultrafast optogenetic control.DepositorInserthChR2
UseAAVTagsmCherryExpressionMammalianMutationE123APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4
Plasmid#170855PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-TGFB3
Plasmid#164429PurposeAAV plasmid expressing TGFB3 in photoreceptorsDepositorAvailable SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM125: pAAV-EFS-CasRx-VEGFA array presgRNA
Plasmid#166873PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA array for RNA-editingDepositorInsertsU6-VEGFA array presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-SnFR-gamma8-minWPRE
Plasmid#165498PurposeAAV for glutamate reporter fused to TARP gamma-8DepositorInsertiGluSnFR extracellular domain fused to TARP gamma-8 via NETO2 TM domain (Cacng8 Synthetic, Rat)
UseAAVPromoterhSynapsinAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-PIK3CD
Plasmid#203730PurposeAAV vector plasmid expressing human phosphoinositide 3-kinase catalytic subunit delta (PIK3CD) under the human synapsin (SYN) promoterDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP306-pAAV-EFS-MCS3-pA
Plasmid#113682PurposeEFS driven Multi Cloning Site-3.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Jaws-KGC-tdTomato-ER2]
Plasmid#153536PurposeAAV-mediated expression of Jaws-KGC-tdTomato-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterSynAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2n-WPRE
Plasmid#218875PurposeAAV-mediated expression of improved GABA sensor (negative change in fluorescence)DepositorInsertiGABASnFR2n
UseAAVExpressionMammalianMutationS99A F104H R168PPromoterSynapsinAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only