We narrowed to 9,067 results for: sgRNA
-
Plasmid#242895PurposePiggyBac cargo vector with XRN2 sgRNA 1 for dox-inducible knockdownDepositorPublicationAvailable sinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only
-
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-mCherry-sgPHIP2
Plasmid#259662PurposeAll-in-one lentiviral vector designed to deliver and express both Cas9 nuclease and sgRNA targeting PHIP (sgPHIP2), with added feature for monitoring (expression of mCherry)DepositorAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-puro-sgPHIP1
Plasmid#259659PurposeAll-in-one lentiviral transfer vector designed to deliver and express both Cas9 nuclease and sgRNA targeting PHIP (sgPHIP1)DepositorAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-puro-sgPHIP2
Plasmid#259660PurposeAll-in-one lentiviral transfer vector designed to deliver and express both Cas9 nuclease and sgRNA targeting PHIP (sgPHIP2)DepositorAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorAvailable sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK1/HRI_sgRNA
Plasmid#218529PurposesgRNA targeting human EIF2AK1/HRIDepositorInsertEIF2AK1 (EIF2AK1 Human)
UseCRISPR and LentiviralAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianPromoterU6Available sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
psPAX2-D64V-NC-COM
Plasmid#131226PurposeExpressing GAG precursor protein, in which COM is inserted after the second zinc finger domain of nucleocapsid protein (NC)DepositorInsertCOM
UseLentiviralExpressionMammalianAvailable sinceOct. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS159
Plasmid#122378PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9-Mxi1 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCB-1
Plasmid#210387PurposeAll-in-one cumate-based inducible CRISPRi plasmid for use in StreptomycesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsdCas9
CymR
sgRNA cassette
UseCRISPR; Integrative vector for use in streptomycesMutationBsaI-flanked RFP cassette inserted in place of sp…PromoterSP11 and SP30Available sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEditC
Plasmid#207532PurposePlasmid for cytidine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA; SmR/SpRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertxylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEditA-RY
Plasmid#207533PurposePlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ABE:SpRY, PEM7→non-specific sgRNA; SmR/SpRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertxylS (cured of BsaI-sites), Pm→ABE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEditC-RY
Plasmid#207534PurposePlasmid for cytidine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→CBE:SpRY, PEM7→non-specific sgRNA; SmR/SpRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertxylS (cured of BsaI-sites), Pm→CBE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgShmt2_1
Plasmid#106314PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only