-
Plasmid#92030Purposeexpresses CRY2 (Full length, mutant NLS) fused to Gal4DNA (residues 1-147) fused to VP16 activation domain (long form)DepositorInsertCRY2 (CRY2 Mustard Weed)
UseTagsGalBD-VP16ExpressionMammalianMutationNLS sequence of CRY2 mutatedPromoterCMVAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-NLS-VP16
Plasmid#103822PurposeSoluble BLInCR transcription activator (transactivation domain of viral VP16 protein) that is recruited to 'localizer' sites upon blue light illuminationDepositorInsertPHR-EYFP-VP16 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationVP16: G126T (silent, G42G)PromoterCMVAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiSIV hSyn HA-NLS-SpCas9-NLS WPRE
Plasmid#236242PurposeLentiviral expression of SpCas9DepositorInsertSpCas9
UseLentiviralTagsExpressionMutationPromoterhuman Synapsin 1Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-LOV2-TMEM106B
Plasmid#233347PurposeStable expression of EGFP-LOV2(G528A, N538E)-TMEM106B in mammalian cells. This construct lacks BAX domain, and causes no rupture upon photostimulation.DepositorInsertsUseRetroviralTagsEGFPExpressionMammalianMutationN-terminus is deleted (TMEM106B 90-274) and N538EPromoterAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
F2RL3-DuET
Plasmid#213237PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertF2RL3 (F2RL3 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
F2RL1-DuET
Plasmid#213235PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertF2RL1 (F2RL1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFSynW SYT9 D197, 199, 330, 332N IRES GFP
Plasmid#195703PurposeLentiviral plasmid encoding SYT9 with D197, 199, 330, 332N mutations followed by an internal ribosomal entry site followed by EGFP under the human synapsin promoterDepositorInsertSyt9 (Syt5 Mouse)
UseLentiviralTagsExpressionMutationfull-length mouse SYT9 with D197, 199, 330, 332N …PromoterAvailable sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorInsertmScarlet-Gphn (isoform C4a) (Gphn Rat, Synthetic)
UseAAVTagsmScarletExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorInsertmScarlet-Gphn (isoform C4d) (Gphn Rat, Synthetic)
UseAAVTagsmScarletExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorInsertmEGFP-Gphn (isoform P1) (Gphn Rat, Synthetic)
UseAAVTagsmEGFPExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorInsertmScarlet-Gphn (isoform P1) (Gphn Rat, Synthetic)
UseAAVTagsmScarletExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorInsertmScarlet-Gphn (isoform C4c) (Gphn Rat, Synthetic)
UseAAVTagsmScarletExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-VP16
Plasmid#183927PurposeOptogenetic PHR domain coupled to GFP and VP16 activation domain; binds to CIBN upon blue light exposureDepositorUseTagsExpressionMammalianMutationnonePromoterCMVAvailable sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_47-300_mCh-SspB (pBS1071)
Plasmid#185294PurposeFor the mammalian expression of the human protein ApoE3_D125I_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I_47-300
UseTagsExpressionMammalianMutationD125IPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_mCh-SspB (pBS1145)
Plasmid#185327PurposeFor the mammalian expression of the human protein ApoE3_D125I attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I
UseTagsExpressionMammalianMutationD125IPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_mCh-SspB (pBS1143)
Plasmid#185325PurposeFor the mammalian expression of the human protein ApoE4 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-SspB (pBS1080)
Plasmid#185303PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only