We narrowed to 12,964 results for: BASE
-
Plasmid#221193PurposeGlcR module template with glcO36 operator: T7 promoDNA template of GlcR sensor with glcO36 operator: T7 promoter-glcO36-3WJdB reporter-T7 terminator linear DNA tter-glcO36-3WJdB reporter-T7 terminatorDepositorInsertT7 promoter-glcO36
UseSynthetic BiologyExpressionBacterialPromoterT7 promoter with downstream glcO36 operatorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEndo-I-OnuI-TSM
Plasmid#207954PurposeExpresses a fusion of the homing endonuclease I-OnuI with the thermosensitive L212P VMA1 intein. Endonuclease activity is restricted to lower temperatures.DepositorInsertThermosensitive fusion of I-OnuI and the L212P VMA1 intein.
UseSynthetic BiologyExpressionBacterialMutationLeucine 212 changed to proline, leucine 434 in fu…Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Src(YF)-SsrA(Y7I)-mCer3
Plasmid#220999Purposethis is microTag (Y7I mutation in SsrA)-Src(Y529F) with mCerulean3 at C-terminalDepositorInsertSrc, SsrA, mCerulean3 (Src Mouse)
TagsmCerulean3ExpressionMammalianMutationY529F in Src, Y7I in SsrAPromoterCMVAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCMV-mScarlet-I-eDHFR-ORP5(ΔPH)
Plasmid#214277PurposeMammalian expression of ORP5(ΔPH) fused to mScarlet-I-tagged E. coli DHFRDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP782_Traptavidin-KRAB-CO
Plasmid#211775PurposeAviTag counterpart binding domain, Traptavidin, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertSpyCatcher-DNMT3A
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceFeb. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R/K63R)-yeGFP-His6
Plasmid#212785PurposeC-terminal PCR-based tagging with CUbo(K48R/K63R)-yeGFP-His6 in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-mXRCC1pd-eGFP
Plasmid#206035PurposeMammalian expression of PAR-deficient mXRCC1pd coupled to eGFP under the control of a EF1a promoterDepositorInsertmXRCC1pd
TagseGFPExpressionMammalianMutationS105A, S186A, K188A, S195A, S221A, S222A,S238A, S…PromoterEf1aAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-hXRCC1pd-HIS
Plasmid#206036PurposeBacterial expression of PAR-deficient hXRCC1pd with 6xHis tag, under the control of T7 promoterDepositorInserthXRCC1
TagsHISExpressionBacterialMutationS103A,R186A,S184A,S193A,S219A,S220A,S236A,S268APromoterT7Available SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP785_Traptavidin-DNMT3A-CO
Plasmid#211778PurposeAviTag counterpart binding domain, Traptavidin, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertTraptavidin-EZH2
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect EZH2 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP781_SnoopCatcher-KRAB-CO
Plasmid#211774PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertTraptavidin-KRAB
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL670
Plasmid#196818PurposeLrCas9 cytosine base editing plasmid in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL671
Plasmid#196819PurposeLrCas9 cytosine base editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL672
Plasmid#196820PurposeLrCas9 adenine base editing plasmid V1.0 in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL673
Plasmid#196821PurposeLrCas9 adenine base editing plasmid V2.0 in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGA-red-mini
Plasmid#196338PurposeEasy-MISE toolkit Level 1 destination plasmid for cassette cloning with BsaI-based Golden Gate Assembly; allowing fast postitive clones test with mRFP1 fluorescent protein-based red/white screeningDepositorTypeEmpty backboneUseSynthetic Biology; Golden gate assembly backboneAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGA-red-maxi
Plasmid#196337PurposeEasy-MISE toolkit Level 1 destination plasmid for cassette cloning with BsaI-based Golden Gate Assembly; allowing fast postitive clones test with mRFP1 fluorescent protein-based red/white screeningDepositorTypeEmpty backboneUseSynthetic Biology; Golden gate assembly backboneAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQC.SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(Q5A)]-Fluc
Plasmid#200127PurposeRetroviral expression of SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(Q5A)] protease reporter and P2A firefly luciferase in mammalian cellsDepositorInsertFlip-nluc(LgBiT1-8)CP[CoVA(Q5A)] P2A firefly luciferase
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQC.SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(SA)]-Fluc
Plasmid#200128PurposeRetroviral expression of SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA(SA)] protease reporter and P2A firefly luciferase in mammalian cellsDepositorInsertFlip-nluc(LgBiT1-8)CP[CoVA(SA)] P2A firefly luciferase
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQC.SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA]-Fluc
Plasmid#200126PurposeRetroviral expression of SARS2_5'UTR(SL1)-Flip-nluc(LgBiT1-8)CP[CoVA] protease reporter and P2A firefly luciferase in mammalian cellsDepositorInsertFlip-nluc(LgBiT1-8)CP[CoVA] P2A firefly luciferase
UseRetroviralExpressionMammalianPromoterCMVAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG.Myc-SARS2_3CL(C145A)
Plasmid#200121PurposeExpresses N-terminal Myc-tagged human codon optimyzed SARS-CoV-2 3CL C145A in mammalian cellsDepositorInsertSARS-CoV-2 3CL protease (ORF1ab SARS-CoV-2)
TagsMycExpressionMammalianMutationC145APromoterCAGAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP70_pU.CAG.Cas9-D10A-K848A-R1060A.rBGpA
Plasmid#199254PurposeExpression construct encoding the high specificity SpCas9-KARA-D10A nickaseDepositorInsertHigh specificity S. pyogenes Cas9-D10A-KARA nickase
UseCRISPRTags3XFLAG epitope, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationD10A K848A R1060APromoterCAG promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP76_pU.CAG.Cas9-D10A-K848A.rBGpA
Plasmid#199253PurposeExpression construct encoding the high specificity SpCas9-KA-D10A nickaseDepositorInsertHigh specificity S. pyogenes Cas9-D10A-KA nickase
UseCRISPRTags3XFLAG epitope, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationD10A K848APromoterCAG promoterAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPT-mEGFP
Plasmid#190606PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)DepositorInsertsmEGFP
mCherry
UseLentiviralMutationa deletion was created in mCherry CDS impairing i…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15541_dCBE-SuperFi-Cas9
Plasmid#184371PurposeMammalian expression of nuclease inactive SuperFi-Cas9 CBE base editorDepositorInsertdCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15543_dABE-SuperFi-Cas9
Plasmid#184373PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE7 base editorDepositorInsertdABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15545_dABE8e-SuperFi-Cas9
Plasmid#184375PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE8e base editorDepositorInsertdABE8e-SuperFi-Cas9
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRD445
Plasmid#168775PurposeExpression of mEos3.2 in MycobacteriumDepositorInsertmEos3.2
ExpressionBacterialAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-MCS-LexA-VP16-MiniWhite
Plasmid#165900PurposeBlasticidin resistant LexA driver vector with Mini-white CDS eye marker. Contains an enhancer grammar GB20 entry point for custom enhancers. Standard cut-and-paste cloning can also be used. Vector uses Purple-White bacteria colony screening for identification of correct cloningDepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NI_G1333-DddtoxA-C
Plasmid#171724PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NN_G1333-DddtoxA-C
Plasmid#171728PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of a cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NG_G1333-DddtoxA-C
Plasmid#171732PurposeptpTALECD vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NI_G1333-DddtoxA-N
Plasmid#171725PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NN_G1333-DddtoxA-N
Plasmid#171729PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NG_G1333-DddtoxA-N
Plasmid#171733PurposeptpTALECD vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbB8k-csg-NbSARS
Plasmid#171703PurposeArabinose-inducible csgBACEFG operon for curli fiber synthesis in which curli subunit CsgA is fused to a cross-reactive nanobody targeting the spike protein of betacoronaviruses via a flexible linker.DepositorInsertcsgBACEFG, with nanobody fused to CsgA
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-GCaMP6f-4x128-mAGNET
Plasmid#166023PurposeExpresses GCaMP6f in CaMKII+ cells with low miRNA-128 expressionDepositorInsertGCaMP6f with 4 miR-128 binding sites
UseAAV and Mouse TargetingTagsNoneExpressionMammalianAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-mRuby2-4x128-mAGNET
Plasmid#166021PurposeExpresses mRuby in CaMKII+ cells with low miRNA-128 expressionDepositorInsertmRuby2 with 4 miR-128 binding sites
UseAAV and Mouse TargetingTagsNoneExpressionMammalianMutationNoneAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-GFP
Plasmid#166840PurposeExpresses ER localized Vac8-GFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsGFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 TNos:Luc:5'UTR (GB1499)
Plasmid#160580PurposeReversed sequences of the NOS terminator, Firefly Luciferase CDS and 5' UTR of 35S promoterDepositorInsertLuc
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 integrase (GB1561)
Plasmid#160586PurposeStreptomyces phage PhiC31 integrase, adapted for C-terminal fusionsDepositorInsertPhiC31
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 linker-RDF (GB2892)
Plasmid#160604PurposeRDF sequence for C-terminal fusion with PhiC31 recombinase, together with a 18-nt linker sequenceDepositorInsertRDF
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-mCherry-C
Plasmid#159437PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorInsertmCherry
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…PromoterCMVAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTW927
Plasmid#115961PurposeORF insert for replicon MoCloDepositorInsertLvl0 ORF TetR-2A-mKate-PEST GG
UseSynthetic BiologyAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.-1
Plasmid#133539PurposesfGFP driven by a T7 promoter with the tetO sequence 36 bp upstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.25
Plasmid#133538PurposesfGFP driven by a T7 promoter with the tetO sequence 28 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only